Incidental Mutation 'R5723:Akt1'
ID501441
Institutional Source Beutler Lab
Gene Symbol Akt1
Ensembl Gene ENSMUSG00000001729
Gene Namethymoma viral proto-oncogene 1
SynonymsPKBalpha, PKB/Akt, Akt, PKB
MMRRC Submission 043341-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R5723 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location112653821-112674884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112657270 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 276 (K276E)
Ref Sequence ENSEMBL: ENSMUSP00000122222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001780] [ENSMUST00000128300] [ENSMUST00000130342] [ENSMUST00000144550]
Predicted Effect probably damaging
Transcript: ENSMUST00000001780
AA Change: K276E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001780
Gene: ENSMUSG00000001729
AA Change: K276E

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
S_TKc 150 408 1.56e-107 SMART
S_TK_X 409 476 1.44e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127902
Predicted Effect probably damaging
Transcript: ENSMUST00000128300
AA Change: K276E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122222
Gene: ENSMUSG00000001729
AA Change: K276E

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
Pfam:Pkinase 150 278 1e-31 PFAM
Pfam:Pkinase_Tyr 150 278 3.8e-13 PFAM
Pfam:Pkinase_Tyr 276 350 8.7e-6 PFAM
Pfam:Pkinase 277 365 5e-17 PFAM
S_TK_X 366 433 1.44e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130342
SMART Domains Protein: ENSMUSP00000118190
Gene: ENSMUSG00000001729

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139388
Predicted Effect probably benign
Transcript: ENSMUST00000144550
SMART Domains Protein: ENSMUSP00000123689
Gene: ENSMUSG00000001729

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
Pfam:Pkinase 150 202 2.6e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184981
Meta Mutation Damage Score 0.434 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes the founding member of the Akt serine-threonine protein kinase gene family that also includes Akt2 and Akt3. This kinase is a major downstream effector of the phosphatidylinositol 3-kinase (PI3K) pathway that mediates the effects of various growth factors such as platelet-derived growth factor (PDGF), epidermal growth factor (EGF), insulin and insulin-like growth factor I (IGF-I). It is activated through recruitment to cellular membranes by PI3K lipid products and by phosphorylation by 3-phosphoinositide dependent kinase-1. It then further phosphorylates different downstream proteins in response to various extracellular signals and thus plays a pivotal role in mediating a variety of cellular processes, such as glucose metabolism, glycogen biosynthesis, protein synthesis and turn over, inflammatory response, cell survival (anti-apoptosis) and development. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mutant homozygotes are smaller than sibs due to retarded prenatal and postnatal growth and exhibit increased apoptosis and decreased lifespan with genotoxic stress. Mice are fertile, but males have attenuated spermatogenesis and abnormal testes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,953,619 D862G possibly damaging Het
Abcg2 C T 6: 58,678,351 Q109* probably null Het
Acbd7 A G 2: 3,340,418 Y33C probably damaging Het
Actl7a A G 4: 56,744,310 D279G probably damaging Het
Akr1c18 A T 13: 4,144,329 Y110* probably null Het
Bcas2 A G 3: 103,177,292 probably benign Het
C9 T A 15: 6,486,816 Y367N probably damaging Het
Cd163 A G 6: 124,319,063 T789A probably benign Het
Cers6 T A 2: 69,108,445 S344T probably benign Het
Clcn4 A G 7: 7,291,682 V329A probably damaging Het
Crisp3 A C 17: 40,235,913 V38G probably damaging Het
Cyp2b23 A G 7: 26,681,396 F135L probably benign Het
Ddr2 A T 1: 169,988,520 C539* probably null Het
Efna5 T A 17: 62,607,463 D189V probably damaging Het
Endov G T 11: 119,499,849 V70F probably damaging Het
Fam49b A T 15: 63,956,598 probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Frem3 A T 8: 80,613,397 H773L probably benign Het
Gm43302 T A 5: 105,217,486 Q552L possibly damaging Het
Gramd1a A T 7: 31,134,483 W506R probably damaging Het
Hmcn1 C T 1: 150,694,849 V2188I possibly damaging Het
Ifit1bl2 A G 19: 34,620,058 F53L probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif5a GGGTTGGT GGGT 10: 127,231,029 probably null Het
Krt16 A G 11: 100,248,446 Y149H probably damaging Het
Krtap5-2 A T 7: 142,175,005 C313S unknown Het
Mreg A G 1: 72,162,368 I155T probably damaging Het
Nans T C 4: 46,499,083 F130S probably benign Het
Nox4 T C 7: 87,304,973 probably benign Het
Olfr178 A T 16: 58,889,613 Y202* probably null Het
Olfr411 C A 11: 74,347,128 W32L possibly damaging Het
Olfr600 A T 7: 103,346,619 M103K possibly damaging Het
Olfr679 C A 7: 105,091,102 C179F probably damaging Het
Pkd1 A G 17: 24,565,523 T348A probably benign Het
Poteg T C 8: 27,449,992 probably null Het
Prom1 T G 5: 44,014,894 N585T probably benign Het
Rfc1 T C 5: 65,277,426 S666G probably null Het
Rilp A G 11: 75,512,861 probably benign Het
Serpina3i A G 12: 104,265,500 E132G probably benign Het
Serpina3m T C 12: 104,393,911 V414A probably damaging Het
Sfrp4 T C 13: 19,623,698 F89S probably damaging Het
Stat5a A G 11: 100,882,074 H692R probably benign Het
Tex29 A T 8: 11,854,279 probably benign Het
Tmc5 T A 7: 118,672,193 F910I probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tusc3 G A 8: 39,071,497 G230D possibly damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Upb1 A T 10: 75,428,271 I184F probably damaging Het
Vamp4 T C 1: 162,574,363 F5L possibly damaging Het
Zfp583 C A 7: 6,323,675 Q68H probably damaging Het
Zfp831 A C 2: 174,645,407 H625P probably benign Het
Zfp941 G A 7: 140,812,850 probably benign Het
Other mutations in Akt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Akt1 APN 12 112657671 missense probably damaging 1.00
IGL01779:Akt1 APN 12 112657169 missense probably damaging 1.00
IGL01886:Akt1 APN 12 112659158 missense probably benign 0.16
IGL02506:Akt1 APN 12 112659280 splice site probably benign
IGL02851:Akt1 APN 12 112657084 missense probably damaging 1.00
R0211:Akt1 UTSW 12 112655142 missense probably damaging 0.98
R0211:Akt1 UTSW 12 112655142 missense probably damaging 0.98
R1891:Akt1 UTSW 12 112659575 missense probably damaging 1.00
R1988:Akt1 UTSW 12 112655151 missense probably benign 0.02
R2018:Akt1 UTSW 12 112659625 missense probably damaging 0.99
R2019:Akt1 UTSW 12 112659625 missense probably damaging 0.99
R2023:Akt1 UTSW 12 112659637 missense probably benign 0.33
R3873:Akt1 UTSW 12 112656533 missense probably benign
R4446:Akt1 UTSW 12 112659133 missense probably benign 0.05
R4832:Akt1 UTSW 12 112657087 missense probably damaging 1.00
R5457:Akt1 UTSW 12 112657091 missense probably damaging 0.96
R5595:Akt1 UTSW 12 112658616 missense probably null 0.99
R5736:Akt1 UTSW 12 112656850 missense probably benign 0.12
R6058:Akt1 UTSW 12 112662200 missense probably damaging 0.99
R6473:Akt1 UTSW 12 112662260 missense probably damaging 1.00
R7045:Akt1 UTSW 12 112662301 nonsense probably null
R7129:Akt1 UTSW 12 112659649 missense probably benign 0.22
R7311:Akt1 UTSW 12 112657153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCTTCATAGTGGCACCG -3'
(R):5'- CAGTCTCCAGTTCTCTTTGGGG -3'

Sequencing Primer
(F):5'- ATAGTGGCACCGTCCTTGATC -3'
(R):5'- GGGGGCTAGTTCCTAACCTTC -3'
Posted On2017-12-01