Incidental Mutation 'R5731:Kit'
ID501467
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene NameKIT proto-oncogene receptor tyrosine kinase
SynonymsSCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
MMRRC Submission 043192-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R5731 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location75574916-75656722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75654415 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 933 (I933N)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005815
AA Change: I937N

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: I937N

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144270
AA Change: I933N

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: I933N

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202167
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik A G 8: 33,429,325 I58V unknown Het
Abca4 G T 3: 122,132,593 G1226V probably damaging Het
Arl9 T C 5: 77,006,527 V34A possibly damaging Het
Bpifb9a A T 2: 154,262,243 N202I possibly damaging Het
C1qtnf6 A T 15: 78,527,314 M54K probably benign Het
Ccdc62 T C 5: 123,951,289 probably benign Het
Cd177 A G 7: 24,744,421 C751R probably damaging Het
Clcn3 T C 8: 60,922,889 I684V possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dag1 T C 9: 108,218,111 T61A probably benign Het
Fam184b C T 5: 45,553,129 G553E probably benign Het
Fkbp15 G C 4: 62,306,929 A831G probably benign Het
Flt1 T C 5: 147,678,152 H328R probably benign Het
Fmnl2 T A 2: 53,118,137 probably benign Het
Gm5431 A G 11: 48,894,448 Y89H probably damaging Het
Gprin2 C A 14: 34,195,440 L124F probably damaging Het
Hacd2 T A 16: 35,102,004 Y188N probably damaging Het
Itgad A G 7: 128,198,554 T950A probably benign Het
Klhl11 A T 11: 100,463,763 Y411N probably damaging Het
N4bp2 T C 5: 65,809,157 S1313P probably damaging Het
Neurog1 T C 13: 56,251,541 K131R probably damaging Het
Olfr1155 T A 2: 87,943,427 H67L possibly damaging Het
Olfr745 T C 14: 50,642,791 L170P probably damaging Het
Otogl T C 10: 107,881,464 D382G probably damaging Het
Pcdh1 A C 18: 38,198,598 F590V probably damaging Het
Pcdha5 G A 18: 36,960,767 V110M probably damaging Het
Pdlim3 A G 8: 45,915,247 N261D probably benign Het
Pou4f1 T C 14: 104,465,911 T362A unknown Het
Prlr A G 15: 10,314,135 T9A probably benign Het
Psmb7 T C 2: 38,588,277 Y245C probably damaging Het
Ryr3 T A 2: 112,641,572 D4544V probably damaging Het
Svop T C 5: 114,060,063 K149E probably damaging Het
Tlr3 A G 8: 45,398,120 V580A probably benign Het
Tm4sf20 T G 1: 82,760,292 I93L probably benign Het
Ugt2b5 T A 5: 87,140,252 R19* probably null Het
Vmn2r28 G T 7: 5,488,669 T193K probably benign Het
Vps13c A G 9: 67,895,379 D654G probably damaging Het
Zfyve16 T A 13: 92,508,193 Q1167L probably benign Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.00
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.98
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense possibly damaging 0.66
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign
IGL03381:Kit APN 5 75607128 missense probably benign 0.04
Casper UTSW 5 75645875 missense probably damaging 1.00
pretty2 UTSW 5 75649550 missense probably damaging 1.00
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0254:Kit UTSW 5 75620921 missense probably benign
R0329:Kit UTSW 5 75652829 missense probably damaging 1.00
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1068:Kit UTSW 5 75609518 missense probably benign
R1115:Kit UTSW 5 75649532 splice site probably benign
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably benign 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably benign
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense probably benign 0.40
R6270:Kit UTSW 5 75609509 missense probably benign
R6565:Kit UTSW 5 75645853 missense probably damaging 1.00
R6694:Kit UTSW 5 75640757 missense possibly damaging 0.94
U24488:Kit UTSW 5 75623014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCAGTGTTGTACCTCATTC -3'
(R):5'- ACTCGCTACCCTGGAATAGG -3'

Sequencing Primer
(F):5'- CATTCTCGAAATGATTTACCTGGGG -3'
(R):5'- GTAACCATCACAGAAGCCAGAAGG -3'
Posted OnDec 01, 2017