Incidental Mutation 'R5742:Fez1'
ID501480
Institutional Source Beutler Lab
Gene Symbol Fez1
Ensembl Gene ENSMUSG00000032118
Gene Namefasciculation and elongation protein zeta 1 (zygin I)
SynonymsUNC-76, UNC76
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5742 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location36821864-36878924 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 36850447 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034630] [ENSMUST00000161500] [ENSMUST00000162633] [ENSMUST00000163816]
Predicted Effect probably null
Transcript: ENSMUST00000034630
SMART Domains Protein: ENSMUSP00000034630
Gene: ENSMUSG00000032118

DomainStartEndE-ValueType
Pfam:FEZ 58 300 3.4e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160041
SMART Domains Protein: ENSMUSP00000124648
Gene: ENSMUSG00000032118

DomainStartEndE-ValueType
Pfam:FEZ 35 87 4.6e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161500
SMART Domains Protein: ENSMUSP00000123762
Gene: ENSMUSG00000032118

DomainStartEndE-ValueType
Pfam:FEZ 58 167 5.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162633
SMART Domains Protein: ENSMUSP00000124634
Gene: ENSMUSG00000032118

DomainStartEndE-ValueType
Pfam:FEZ 58 123 6.3e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163816
SMART Domains Protein: ENSMUSP00000126072
Gene: ENSMUSG00000032118

DomainStartEndE-ValueType
Pfam:FEZ 58 297 2.7e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216539
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an ortholog of the C. elegans unc-76 gene, which is necessary for normal axonal bundling and elongation within axon bundles. Expression of this gene in C. elegans unc-76 mutants can restore to the mutants partial locomotion and axonal fasciculation, suggesting that it also functions in axonal outgrowth. The N-terminal half of the gene product is highly acidic. Alternatively spliced transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit hyperactivity and increased sensitivity to methamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C T 11: 72,165,553 A794T possibly damaging Het
Abca9 T G 11: 110,160,417 E151A probably damaging Het
Abcb5 A G 12: 118,918,257 V579A probably damaging Het
Apob T A 12: 8,007,191 L1858Q probably damaging Het
Cerk C T 15: 86,141,572 E223K probably damaging Het
Cntnap2 T A 6: 45,920,926 Y179* probably null Het
Ddx60 A T 8: 61,948,921 Y277F probably benign Het
Dlgap1 T G 17: 70,718,199 V538G probably benign Het
Duox2 A G 2: 122,284,921 I1050T probably benign Het
Dusp10 A G 1: 184,037,656 probably null Het
Dusp27 A T 1: 166,099,454 V863E probably benign Het
Dync2h1 T A 9: 7,165,762 I500F possibly damaging Het
Erich3 T A 3: 154,733,323 C398S probably damaging Het
Fam213a T C 14: 41,002,503 E57G possibly damaging Het
Fkbp3 A C 12: 65,070,038 H41Q probably benign Het
Fras1 C G 5: 96,768,381 Q3425E possibly damaging Het
Fuca1 T C 4: 135,922,975 V119A probably damaging Het
Grhl2 A G 15: 37,328,372 K414R probably damaging Het
Heatr5a A T 12: 51,955,552 C200* probably null Het
Hmgcs2 A G 3: 98,297,516 N330S probably benign Het
Hspd1 A G 1: 55,084,607 V118A probably benign Het
Jmjd1c A G 10: 67,220,333 T511A probably benign Het
Kat6b T C 14: 21,668,435 S1061P probably damaging Het
Kcnh6 T C 11: 106,009,142 V79A probably benign Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Klc4 C T 17: 46,642,271 R111Q probably damaging Het
Lrp1 T C 10: 127,548,347 D3641G probably damaging Het
Map2k1 A T 9: 64,193,771 D208E probably damaging Het
Masp1 T A 16: 23,454,925 M588L probably benign Het
Mgl2 T A 11: 70,136,684 N239K probably benign Het
Mki67 G A 7: 135,704,373 T625M probably benign Het
Ndufb5 T C 3: 32,747,781 Y112H probably damaging Het
Npr3 A G 15: 11,883,408 S312P probably damaging Het
Nuf2 A T 1: 169,516,622 I125N probably damaging Het
Obox1 G A 7: 15,555,505 G73D possibly damaging Het
Olfr27 T A 9: 39,144,678 F193I probably benign Het
Olfr644 G T 7: 104,068,205 H275Q probably damaging Het
Pcdhb15 T C 18: 37,474,767 S351P probably damaging Het
Phc2 G T 4: 128,745,868 R121L probably damaging Het
Pla2g2a A G 4: 138,833,342 K87E probably benign Het
Plekhh2 T A 17: 84,597,980 S1101T probably damaging Het
Ppp4r1 T C 17: 65,837,746 I786T probably damaging Het
Ros1 A T 10: 52,142,138 probably null Het
Trnt1 T A 6: 106,778,917 L311* probably null Het
Ttc25 G A 11: 100,545,873 G25R possibly damaging Het
Vmn1r47 T A 6: 90,022,518 L211M probably damaging Het
Zfp12 A G 5: 143,245,190 E424G probably damaging Het
Zranb2 T A 3: 157,540,703 Y17* probably null Het
Other mutations in Fez1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02540:Fez1 APN 9 36850399 missense probably damaging 0.97
R1280:Fez1 UTSW 9 36870549 frame shift probably null
R1458:Fez1 UTSW 9 36870549 frame shift probably null
R1741:Fez1 UTSW 9 36843733 missense probably damaging 1.00
R1846:Fez1 UTSW 9 36867767 missense probably damaging 1.00
R2072:Fez1 UTSW 9 36867945 missense probably benign 0.00
R4193:Fez1 UTSW 9 36843727 missense probably damaging 1.00
R4214:Fez1 UTSW 9 36870488 missense probably damaging 0.99
R4417:Fez1 UTSW 9 36870472 splice site probably benign
R4696:Fez1 UTSW 9 36870470 splice site probably null
R4735:Fez1 UTSW 9 36860845 nonsense probably null
R4947:Fez1 UTSW 9 36868875 missense probably damaging 0.99
R4950:Fez1 UTSW 9 36867882 missense probably damaging 1.00
R5538:Fez1 UTSW 9 36868876 missense probably damaging 1.00
R5618:Fez1 UTSW 9 36843932 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAGGCAGATGACCTCAG -3'
(R):5'- ACACACTGAGTTTCCTTCCAAC -3'

Sequencing Primer
(F):5'- AGATGACCTCAGCCTGGCAC -3'
(R):5'- ACACTGAGTTTCCTTCCAACCTTATG -3'
Posted On2017-12-01