Incidental Mutation 'R5780:Etfbkmt'
ID501514
Institutional Source Beutler Lab
Gene Symbol Etfbkmt
Ensembl Gene ENSMUSG00000039958
Gene Nameelectron transfer flavoprotein beta subunit lysine methyltransferase
Synonyms4833442J19Rik, Mettl20
MMRRC Submission 043205-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R5780 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location149139849-149151171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 149147159 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 99 (Y99N)
Ref Sequence ENSEMBL: ENSMUSP00000136167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047531] [ENSMUST00000111547] [ENSMUST00000111548] [ENSMUST00000111551] [ENSMUST00000126406] [ENSMUST00000134306] [ENSMUST00000147934] [ENSMUST00000166416] [ENSMUST00000179873]
Predicted Effect probably damaging
Transcript: ENSMUST00000047531
AA Change: Y99N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042102
Gene: ENSMUSG00000039958
AA Change: Y99N

DomainStartEndE-ValueType
Pfam:Methyltransf_16 86 216 2.1e-10 PFAM
Pfam:MTS 91 189 1e-7 PFAM
Pfam:PrmA 94 180 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111547
Predicted Effect probably benign
Transcript: ENSMUST00000111548
Predicted Effect probably damaging
Transcript: ENSMUST00000111551
AA Change: Y99N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107176
Gene: ENSMUSG00000039958
AA Change: Y99N

DomainStartEndE-ValueType
Pfam:Methyltransf_16 86 218 1.9e-10 PFAM
Pfam:MTS 91 187 1.1e-7 PFAM
Pfam:PrmA 94 180 1.5e-12 PFAM
Pfam:Methyltransf_26 109 214 4.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126406
Predicted Effect probably damaging
Transcript: ENSMUST00000134306
AA Change: Y99N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118701
Gene: ENSMUSG00000039958
AA Change: Y99N

DomainStartEndE-ValueType
Pfam:Methyltransf_16 85 158 1.3e-7 PFAM
Pfam:PrmA 94 159 2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147934
SMART Domains Protein: ENSMUSP00000144830
Gene: ENSMUSG00000039958

DomainStartEndE-ValueType
SCOP:d1f3la_ 2 100 4e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166416
AA Change: Y99N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126521
Gene: ENSMUSG00000039958
AA Change: Y99N

DomainStartEndE-ValueType
Pfam:Methyltransf_16 85 159 1.3e-7 PFAM
Pfam:PrmA 94 164 1.4e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179873
AA Change: Y99N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136167
Gene: ENSMUSG00000039958
AA Change: Y99N

DomainStartEndE-ValueType
Pfam:Methyltransf_16 86 218 1.9e-10 PFAM
Pfam:MTS 91 187 1.1e-7 PFAM
Pfam:PrmA 94 180 1.5e-12 PFAM
Pfam:Methyltransf_26 109 214 4.6e-8 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik C T 1: 85,718,318 A189T probably benign Het
Acsm4 A G 7: 119,693,845 E66G possibly damaging Het
Afm A G 5: 90,551,431 E578G possibly damaging Het
Alox5 A T 6: 116,420,349 D291E probably benign Het
Apoa4 A G 9: 46,242,592 M164V possibly damaging Het
Atp6v1a A T 16: 44,114,643 M61K probably benign Het
Avp A G 2: 130,580,709 S159P probably benign Het
Bicra A T 7: 15,979,754 L841Q possibly damaging Het
Cdk5rap1 CTT CT 2: 154,345,868 probably null Het
Clasp2 T G 9: 113,850,152 L246R probably damaging Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dmkn A G 7: 30,777,615 D227G probably damaging Het
Dnah7a G A 1: 53,483,319 A2920V probably benign Het
Epb41l1 C T 2: 156,496,525 R163W probably damaging Het
Fat4 T C 3: 38,980,955 Y2919H probably damaging Het
Fcgbp T A 7: 28,085,218 D234E probably benign Het
Frem1 T C 4: 82,950,415 D1443G probably benign Het
Fscn2 A C 11: 120,366,668 E285A probably benign Het
Gm12794 C T 4: 101,941,527 L232F probably damaging Het
Gm14124 T A 2: 150,266,219 M33K probably benign Het
Hmga2 T A 10: 120,462,678 R79* probably null Het
Hrh3 A T 2: 180,100,815 V308E probably damaging Het
Hsd11b2 G A 8: 105,522,155 G93D probably damaging Het
Hydin T C 8: 110,586,080 F4151S probably damaging Het
Ica1l C A 1: 60,028,215 E5D probably benign Het
Kcnma1 C A 14: 23,386,351 E640* probably null Het
Mdn1 C T 4: 32,722,950 H2422Y probably benign Het
Mgarp T C 3: 51,391,848 T47A probably damaging Het
Mmp13 T G 9: 7,278,952 F348V possibly damaging Het
Mov10l1 A G 15: 89,011,978 D675G probably benign Het
Nxpe3 T A 16: 55,866,441 Q68L probably damaging Het
Olfr1287 A T 2: 111,449,833 D231V probably benign Het
Olfr784 T C 10: 129,388,070 S146P probably damaging Het
Olfr869 T A 9: 20,137,497 M127K probably damaging Het
Pald1 A T 10: 61,339,218 I751N probably damaging Het
Prickle2 T C 6: 92,458,612 T3A probably benign Het
Ros1 A T 10: 52,194,857 C34S probably damaging Het
Sema3f A G 9: 107,682,589 L702P probably damaging Het
Soga1 A G 2: 157,018,490 C1610R probably damaging Het
Sptbn2 T A 19: 4,724,667 L116Q probably damaging Het
Stard9 T C 2: 120,703,396 V3378A probably benign Het
Sycp2l A G 13: 41,129,500 I158V possibly damaging Het
Tbc1d10b G A 7: 127,198,753 R739W possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Ube4b C T 4: 149,331,364 R1091Q probably benign Het
Vwce C A 19: 10,650,619 P481Q probably damaging Het
Other mutations in Etfbkmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02455:Etfbkmt APN 6 149147226 missense probably damaging 1.00
IGL03149:Etfbkmt APN 6 149144283 missense probably damaging 1.00
R0450:Etfbkmt UTSW 6 149150584 missense probably benign 0.02
R0510:Etfbkmt UTSW 6 149150584 missense probably benign 0.02
R1862:Etfbkmt UTSW 6 149144151 start codon destroyed probably null 0.95
R4111:Etfbkmt UTSW 6 149144591 intron probably benign
R4112:Etfbkmt UTSW 6 149144591 intron probably benign
R4786:Etfbkmt UTSW 6 149147246 start codon destroyed probably benign 0.01
R5053:Etfbkmt UTSW 6 149147268 nonsense probably null
R5304:Etfbkmt UTSW 6 149147206 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGCTACAGGCCAGGTAG -3'
(R):5'- TCCTCTTGGGGAAATGAGCC -3'

Sequencing Primer
(F):5'- TACAGGCCAGGTAGGTTCTCTAC -3'
(R):5'- GGGAAATGAGCCCCACTGAATATAC -3'
Posted On2017-12-01