Incidental Mutation 'R5780:Kcnma1'
ID501515
Institutional Source Beutler Lab
Gene Symbol Kcnma1
Ensembl Gene ENSMUSG00000063142
Gene Namepotassium large conductance calcium-activated channel, subfamily M, alpha member 1
SynonymsmSlo1, MaxiK, Slo1, 5730414M22Rik, BK channel alpha subunit, BKCa, Slo
MMRRC Submission 043205-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.846) question?
Stock #R5780 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location23289431-24014491 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 23386351 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 640 (E640*)
Ref Sequence ENSEMBL: ENSMUSP00000152959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065788] [ENSMUST00000074983] [ENSMUST00000100831] [ENSMUST00000112423] [ENSMUST00000145596] [ENSMUST00000163322] [ENSMUST00000172099] [ENSMUST00000177634] [ENSMUST00000179097] [ENSMUST00000179836] [ENSMUST00000188210] [ENSMUST00000188285] [ENSMUST00000188991] [ENSMUST00000190044] [ENSMUST00000190985] [ENSMUST00000223655] [ENSMUST00000223727] [ENSMUST00000223749] [ENSMUST00000224077] [ENSMUST00000224232] [ENSMUST00000224285] [ENSMUST00000224468] [ENSMUST00000224787] [ENSMUST00000224812] [ENSMUST00000225315] [ENSMUST00000225431] [ENSMUST00000225471] [ENSMUST00000225556] [ENSMUST00000225794]
Predicted Effect probably null
Transcript: ENSMUST00000065788
AA Change: E577*
SMART Domains Protein: ENSMUSP00000065293
Gene: ENSMUSG00000063142
AA Change: E577*

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.5e-7 PFAM
Pfam:BK_channel_a 411 509 6.4e-31 PFAM
low complexity region 835 843 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 1005 1031 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000074983
AA Change: E636*
SMART Domains Protein: ENSMUSP00000074511
Gene: ENSMUSG00000063142
AA Change: E636*

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.5e-7 PFAM
Pfam:BK_channel_a 411 509 6.4e-31 PFAM
low complexity region 894 902 N/A INTRINSIC
low complexity region 950 961 N/A INTRINSIC
low complexity region 1064 1090 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100831
AA Change: E607*
SMART Domains Protein: ENSMUSP00000098393
Gene: ENSMUSG00000063142
AA Change: E607*

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.1e-18 PFAM
Pfam:Ion_trans_2 180 268 5.5e-16 PFAM
Pfam:TrkA_N 314 413 7.3e-7 PFAM
Pfam:BK_channel_a 411 509 6.2e-31 PFAM
low complexity region 865 873 N/A INTRINSIC
low complexity region 921 932 N/A INTRINSIC
low complexity region 1035 1061 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112423
AA Change: E523*
SMART Domains Protein: ENSMUSP00000108042
Gene: ENSMUSG00000063142
AA Change: E523*

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
Pfam:Ion_trans 37 208 2.1e-18 PFAM
Pfam:Ion_trans_2 126 214 5.3e-16 PFAM
Pfam:TrkA_N 260 359 7e-7 PFAM
Pfam:BK_channel_a 357 455 6e-31 PFAM
low complexity region 781 789 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 951 977 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000145596
AA Change: E703*
Predicted Effect probably null
Transcript: ENSMUST00000163322
AA Change: E574*
SMART Domains Protein: ENSMUSP00000128553
Gene: ENSMUSG00000063142
AA Change: E574*

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 3.2e-18 PFAM
Pfam:Ion_trans_2 180 268 1.1e-15 PFAM
Pfam:TrkA_N 314 413 7e-7 PFAM
Pfam:BK_channel_a 411 509 6e-31 PFAM
low complexity region 832 840 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 1002 1028 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172099
AA Change: E639*
SMART Domains Protein: ENSMUSP00000132204
Gene: ENSMUSG00000063142
AA Change: E639*

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.6e-7 PFAM
Pfam:BK_channel_a 411 509 6.5e-31 PFAM
low complexity region 897 905 N/A INTRINSIC
low complexity region 953 964 N/A INTRINSIC
low complexity region 1067 1093 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177634
AA Change: E577*
SMART Domains Protein: ENSMUSP00000136447
Gene: ENSMUSG00000063142
AA Change: E577*

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
Pfam:Ion_trans 53 272 4.9e-19 PFAM
Pfam:Ion_trans_2 180 267 1.2e-15 PFAM
Pfam:BK_channel_a 413 508 1.2e-35 PFAM
low complexity region 862 870 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1032 1058 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179097
AA Change: E574*
SMART Domains Protein: ENSMUSP00000136568
Gene: ENSMUSG00000063142
AA Change: E574*

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 4.6e-18 PFAM
Pfam:Ion_trans_2 180 268 1e-15 PFAM
Pfam:TrkA_N 314 413 1.1e-7 PFAM
Pfam:BK_channel_a 411 509 3.2e-31 PFAM
low complexity region 859 867 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 1029 1055 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179836
AA Change: E580*
SMART Domains Protein: ENSMUSP00000137141
Gene: ENSMUSG00000063142
AA Change: E580*

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 4.2e-18 PFAM
Pfam:Ion_trans_2 180 268 9.5e-16 PFAM
Pfam:BK_channel_a 389 457 2.4e-15 PFAM
low complexity region 838 846 N/A INTRINSIC
low complexity region 894 905 N/A INTRINSIC
low complexity region 1008 1034 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000188210
AA Change: E634*
SMART Domains Protein: ENSMUSP00000141069
Gene: ENSMUSG00000063142
AA Change: E634*

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.2e-16 PFAM
Pfam:TrkA_N 439 538 7.8e-7 PFAM
Pfam:BK_channel_a 536 634 5e-31 PFAM
low complexity region 988 996 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
low complexity region 1158 1184 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000188285
AA Change: E761*
SMART Domains Protein: ENSMUSP00000140275
Gene: ENSMUSG00000063142
AA Change: E761*

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.4e-16 PFAM
Pfam:TrkA_N 439 538 8e-7 PFAM
Pfam:BK_channel_a 536 634 5.2e-31 PFAM
low complexity region 1019 1027 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1189 1215 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000188991
AA Change: E757*
SMART Domains Protein: ENSMUSP00000140751
Gene: ENSMUSG00000063142
AA Change: E757*

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 3.3e-18 PFAM
Pfam:Ion_trans_2 305 393 1.1e-15 PFAM
Pfam:TrkA_N 439 538 3.7e-7 PFAM
Pfam:BK_channel_a 536 634 3.4e-31 PFAM
low complexity region 1015 1023 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1185 1211 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190044
AA Change: E699*
SMART Domains Protein: ENSMUSP00000140033
Gene: ENSMUSG00000063142
AA Change: E699*

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.1e-16 PFAM
Pfam:TrkA_N 439 538 7.5e-7 PFAM
Pfam:BK_channel_a 536 634 4.9e-31 PFAM
low complexity region 957 965 N/A INTRINSIC
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1127 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212542
Predicted Effect probably null
Transcript: ENSMUST00000223655
AA Change: E696*
Predicted Effect probably null
Transcript: ENSMUST00000223727
AA Change: E634*
Predicted Effect probably null
Transcript: ENSMUST00000223749
AA Change: E634*
Predicted Effect probably null
Transcript: ENSMUST00000224025
AA Change: E652*
Predicted Effect probably null
Transcript: ENSMUST00000224077
AA Change: E699*
Predicted Effect probably null
Transcript: ENSMUST00000224232
AA Change: E692*
Predicted Effect probably null
Transcript: ENSMUST00000224285
AA Change: E634*
Predicted Effect probably null
Transcript: ENSMUST00000224468
AA Change: E764*
Predicted Effect probably null
Transcript: ENSMUST00000224787
AA Change: E583*
Predicted Effect probably null
Transcript: ENSMUST00000224812
AA Change: E667*
Predicted Effect probably null
Transcript: ENSMUST00000225315
AA Change: E663*
Predicted Effect probably null
Transcript: ENSMUST00000225431
AA Change: E634*
Predicted Effect probably null
Transcript: ENSMUST00000225471
AA Change: E663*
Predicted Effect probably null
Transcript: ENSMUST00000225556
AA Change: E640*
Predicted Effect probably benign
Transcript: ENSMUST00000225794
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to cerebellar ataxia, Purkinje cell dysfunction, uneven gait patterns, bladder hyperactivity, urinary incontinence, abnormal colonic K+ secretion, and hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik C T 1: 85,718,318 A189T probably benign Het
Acsm4 A G 7: 119,693,845 E66G possibly damaging Het
Afm A G 5: 90,551,431 E578G possibly damaging Het
Alox5 A T 6: 116,420,349 D291E probably benign Het
Apoa4 A G 9: 46,242,592 M164V possibly damaging Het
Atp6v1a A T 16: 44,114,643 M61K probably benign Het
Avp A G 2: 130,580,709 S159P probably benign Het
Bicra A T 7: 15,979,754 L841Q possibly damaging Het
Cdk5rap1 CTT CT 2: 154,345,868 probably null Het
Clasp2 T G 9: 113,850,152 L246R probably damaging Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dmkn A G 7: 30,777,615 D227G probably damaging Het
Dnah7a G A 1: 53,483,319 A2920V probably benign Het
Epb41l1 C T 2: 156,496,525 R163W probably damaging Het
Etfbkmt T A 6: 149,147,159 Y99N probably damaging Het
Fat4 T C 3: 38,980,955 Y2919H probably damaging Het
Fcgbp T A 7: 28,085,218 D234E probably benign Het
Frem1 T C 4: 82,950,415 D1443G probably benign Het
Fscn2 A C 11: 120,366,668 E285A probably benign Het
Gm12794 C T 4: 101,941,527 L232F probably damaging Het
Gm14124 T A 2: 150,266,219 M33K probably benign Het
Hmga2 T A 10: 120,462,678 R79* probably null Het
Hrh3 A T 2: 180,100,815 V308E probably damaging Het
Hsd11b2 G A 8: 105,522,155 G93D probably damaging Het
Hydin T C 8: 110,586,080 F4151S probably damaging Het
Ica1l C A 1: 60,028,215 E5D probably benign Het
Mdn1 C T 4: 32,722,950 H2422Y probably benign Het
Mgarp T C 3: 51,391,848 T47A probably damaging Het
Mmp13 T G 9: 7,278,952 F348V possibly damaging Het
Mov10l1 A G 15: 89,011,978 D675G probably benign Het
Nxpe3 T A 16: 55,866,441 Q68L probably damaging Het
Olfr1287 A T 2: 111,449,833 D231V probably benign Het
Olfr784 T C 10: 129,388,070 S146P probably damaging Het
Olfr869 T A 9: 20,137,497 M127K probably damaging Het
Pald1 A T 10: 61,339,218 I751N probably damaging Het
Prickle2 T C 6: 92,458,612 T3A probably benign Het
Ros1 A T 10: 52,194,857 C34S probably damaging Het
Sema3f A G 9: 107,682,589 L702P probably damaging Het
Soga1 A G 2: 157,018,490 C1610R probably damaging Het
Sptbn2 T A 19: 4,724,667 L116Q probably damaging Het
Stard9 T C 2: 120,703,396 V3378A probably benign Het
Sycp2l A G 13: 41,129,500 I158V possibly damaging Het
Tbc1d10b G A 7: 127,198,753 R739W possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Ube4b C T 4: 149,331,364 R1091Q probably benign Het
Vwce C A 19: 10,650,619 P481Q probably damaging Het
Other mutations in Kcnma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kcnma1 APN 14 23314322 splice site probably benign
IGL01520:Kcnma1 APN 14 23501143 missense possibly damaging 0.94
IGL01977:Kcnma1 APN 14 23530299 splice site probably benign
IGL02140:Kcnma1 APN 14 23309045 missense probably damaging 1.00
IGL02165:Kcnma1 APN 14 23336967 missense possibly damaging 0.93
IGL02186:Kcnma1 APN 14 23526813 missense probably benign 0.28
IGL02268:Kcnma1 APN 14 23543076 missense probably damaging 1.00
IGL02353:Kcnma1 APN 14 23591613 missense probably damaging 1.00
IGL02360:Kcnma1 APN 14 23591613 missense probably damaging 1.00
IGL02491:Kcnma1 APN 14 23311689 missense probably damaging 1.00
IGL02552:Kcnma1 APN 14 23386259 critical splice donor site probably null
IGL02625:Kcnma1 APN 14 23363832 missense probably damaging 1.00
IGL02677:Kcnma1 APN 14 23463156 missense probably damaging 1.00
IGL02706:Kcnma1 APN 14 23309154 missense probably damaging 1.00
PIT4495001:Kcnma1 UTSW 14 23425597 missense probably benign 0.00
PIT4514001:Kcnma1 UTSW 14 23309035 splice site probably null
PIT4576001:Kcnma1 UTSW 14 23309035 splice site probably null
R0071:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0071:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0115:Kcnma1 UTSW 14 23314175 missense probably damaging 1.00
R0172:Kcnma1 UTSW 14 23803166 missense probably damaging 1.00
R0178:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0183:Kcnma1 UTSW 14 23508052 missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23494579 missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23494579 missense probably damaging 1.00
R0328:Kcnma1 UTSW 14 23373197 missense probably damaging 1.00
R0501:Kcnma1 UTSW 14 23311716 missense possibly damaging 0.80
R0631:Kcnma1 UTSW 14 23509784 splice site probably benign
R0668:Kcnma1 UTSW 14 23367495 missense probably damaging 1.00
R0811:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R0812:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R1080:Kcnma1 UTSW 14 23494607 missense probably damaging 1.00
R1419:Kcnma1 UTSW 14 23367642 missense probably damaging 0.99
R1446:Kcnma1 UTSW 14 23311724 missense probably damaging 1.00
R1454:Kcnma1 UTSW 14 23463200 missense probably damaging 1.00
R1651:Kcnma1 UTSW 14 23314194 missense probably damaging 1.00
R1826:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1827:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1828:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1864:Kcnma1 UTSW 14 23803162 missense probably damaging 1.00
R2002:Kcnma1 UTSW 14 23337029 missense probably damaging 0.99
R2140:Kcnma1 UTSW 14 23314220 missense probably damaging 1.00
R2278:Kcnma1 UTSW 14 23543083 nonsense probably null
R2866:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2900:Kcnma1 UTSW 14 23803160 missense probably damaging 1.00
R3820:Kcnma1 UTSW 14 23299938 missense possibly damaging 0.66
R3821:Kcnma1 UTSW 14 23367611 missense probably damaging 1.00
R3901:Kcnma1 UTSW 14 23505255 missense probably damaging 0.98
R3975:Kcnma1 UTSW 14 24003747 critical splice donor site probably null
R3976:Kcnma1 UTSW 14 24003747 critical splice donor site probably null
R4352:Kcnma1 UTSW 14 23311652 missense probably damaging 1.00
R4517:Kcnma1 UTSW 14 23337029 missense probably damaging 1.00
R4598:Kcnma1 UTSW 14 23803160 missense probably damaging 1.00
R4604:Kcnma1 UTSW 14 23309038 critical splice donor site probably null
R4743:Kcnma1 UTSW 14 23803202 missense probably damaging 1.00
R4754:Kcnma1 UTSW 14 23363836 missense probably damaging 0.96
R4908:Kcnma1 UTSW 14 23309152 missense probably damaging 0.99
R4960:Kcnma1 UTSW 14 24004118 intron probably benign
R5175:Kcnma1 UTSW 14 23336038 critical splice donor site probably null
R5218:Kcnma1 UTSW 14 23463185 missense probably damaging 0.96
R5435:Kcnma1 UTSW 14 23528404 nonsense probably null
R5705:Kcnma1 UTSW 14 24003771 missense possibly damaging 0.73
R5746:Kcnma1 UTSW 14 23494567 missense probably damaging 1.00
R5793:Kcnma1 UTSW 14 23309035 splice site probably null
R6039:Kcnma1 UTSW 14 23309037 missense probably benign 0.42
R6039:Kcnma1 UTSW 14 23309037 missense probably benign 0.42
R6133:Kcnma1 UTSW 14 24003868 missense probably damaging 0.98
R6271:Kcnma1 UTSW 14 23509889 missense probably damaging 1.00
R6490:Kcnma1 UTSW 14 23336097 missense possibly damaging 0.46
R6704:Kcnma1 UTSW 14 24002814 nonsense probably null
R6822:Kcnma1 UTSW 14 24003744 splice site probably null
R6855:Kcnma1 UTSW 14 23367611 missense probably damaging 1.00
R6920:Kcnma1 UTSW 14 23526534 critical splice donor site probably null
R7017:Kcnma1 UTSW 14 23494643 missense possibly damaging 0.79
R7081:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R7113:Kcnma1 UTSW 14 23463156 missense probably damaging 1.00
R7131:Kcnma1 UTSW 14 23367494 missense probably damaging 1.00
R7172:Kcnma1 UTSW 14 23526623 missense probably damaging 1.00
R7207:Kcnma1 UTSW 14 23309015 makesense probably null
R7308:Kcnma1 UTSW 14 23330935 missense probably damaging 0.99
R7371:Kcnma1 UTSW 14 23494570 missense possibly damaging 0.94
R7404:Kcnma1 UTSW 14 24002834 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCTAACGATCTGGCTCCCC -3'
(R):5'- TCAGCTGGTCTCACTGACTAACG -3'

Sequencing Primer
(F):5'- CCCATGGAGCTGAGTAGGG -3'
(R):5'- AACGCATCCAGTCTTTGTCATGG -3'
Posted On2017-12-01