Incidental Mutation 'R5835:Capn12'
ID501586
Institutional Source Beutler Lab
Gene Symbol Capn12
Ensembl Gene ENSMUSG00000054083
Gene Namecalpain 12
Synonyms
MMRRC Submission 044056-MU
Accession Numbers

Ncbi RefSeq: NM_001110807.1; MGI: 1891369

Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R5835 (G1)
Quality Score169
Status Not validated
Chromosome7
Chromosomal Location28881422-28893563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 28881958 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 79 (H79N)
Ref Sequence ENSEMBL: ENSMUSP00000069055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066880]
Predicted Effect probably benign
Transcript: ENSMUST00000066880
AA Change: H79N

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000069055
Gene: ENSMUSG00000054083
AA Change: H79N

DomainStartEndE-ValueType
CysPc 27 349 7.8e-139 SMART
calpain_III 353 529 7.47e-72 SMART
SCOP:d1alva_ 552 720 3e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes a member of the calpain large subunit family. [provided by RefSeq, Jun 2012]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A2m A G 6: 121,639,336 K141R probably damaging Het
Ablim3 T C 18: 61,823,922 E278G probably damaging Het
Adam28 A G 14: 68,655,681 W4R possibly damaging Het
Ahnak2 T C 12: 112,775,796 N614S possibly damaging Het
Arfgef1 A G 1: 10,160,739 S1182P probably damaging Het
Asb8 A T 15: 98,136,382 D97E probably damaging Het
AU041133 T A 10: 82,151,212 L232H probably damaging Het
Bmp2k T G 5: 97,056,982 V392G possibly damaging Het
Casp2 C A 6: 42,267,586 S54R possibly damaging Het
Ccdc18 T C 5: 108,140,874 S163P possibly damaging Het
Ccdc92b A G 11: 74,638,012 E114G probably benign Het
Cd209c C A 8: 3,945,699 M34I probably benign Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cndp1 C A 18: 84,612,833 A434S probably benign Het
Crybg1 T A 10: 43,975,133 T1581S probably benign Het
Cyb5d2 A T 11: 72,789,210 D86E probably damaging Het
Duox1 T G 2: 122,327,860 V608G probably benign Het
Exosc10 A G 4: 148,565,387 R425G probably damaging Het
Fat3 A T 9: 16,375,833 I798N probably damaging Het
Habp2 T A 19: 56,306,786 D36E probably benign Het
Herpud1 T C 8: 94,392,239 V207A probably damaging Het
Htt A G 5: 34,813,190 I561V probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Igkv18-36 A G 6: 69,992,528 I93T probably damaging Het
Kalrn T G 16: 33,987,091 E2636A probably benign Het
Kif27 A G 13: 58,313,146 probably null Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Myh6 T C 14: 54,950,407 K1197E probably damaging Het
Obscn T C 11: 59,002,081 T6780A probably benign Het
Obscn C T 11: 59,042,127 V4808M probably damaging Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Pkhd1 T C 1: 20,201,083 D3082G probably benign Het
Plch1 T C 3: 63,697,522 M1645V probably benign Het
Ppip5k1 A G 2: 121,337,899 V674A probably benign Het
Prrc2b T A 2: 32,206,473 S619T probably benign Het
Rab44 A T 17: 29,148,238 H714L probably benign Het
Rybp A G 6: 100,233,190 Y70H possibly damaging Het
Sfrp1 A G 8: 23,446,244 K234R possibly damaging Het
Slc1a2 A G 2: 102,777,450 N481S probably damaging Het
Slc44a3 T G 3: 121,527,200 I51L probably benign Het
Slitrk1 A G 14: 108,911,572 F569S possibly damaging Het
Smurf2 A T 11: 106,836,148 N451K probably damaging Het
Sptbn2 T A 19: 4,738,219 D1075E probably damaging Het
Syngap1 A T 17: 26,958,218 H65L probably benign Het
Tdrd12 T C 7: 35,529,264 D11G probably damaging Het
Tex2 C T 11: 106,519,913 A926T unknown Het
Tm7sf2 A G 19: 6,063,884 F209S probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Virma T A 4: 11,514,036 L630H probably damaging Het
Vmn1r68 A G 7: 10,527,820 I117T possibly damaging Het
Zan C A 5: 137,456,655 R1373L unknown Het
Other mutations in Capn12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01717:Capn12 APN 7 28889105 missense probably benign
IGL01758:Capn12 APN 7 28886623 splice site probably null
IGL02381:Capn12 APN 7 28886455 splice site probably benign
IGL02863:Capn12 APN 7 28883156 missense probably damaging 1.00
IGL03237:Capn12 APN 7 28890941 missense probably damaging 1.00
PIT4418001:Capn12 UTSW 7 28886536 missense probably benign 0.06
R0027:Capn12 UTSW 7 28881960 missense probably benign 0.01
R0047:Capn12 UTSW 7 28890387 critical splice donor site probably null
R0047:Capn12 UTSW 7 28890387 critical splice donor site probably null
R0070:Capn12 UTSW 7 28889126 unclassified probably benign
R0070:Capn12 UTSW 7 28889126 unclassified probably benign
R0533:Capn12 UTSW 7 28887683 missense possibly damaging 0.48
R0932:Capn12 UTSW 7 28887698 missense possibly damaging 0.91
R1524:Capn12 UTSW 7 28882764 splice site probably benign
R4758:Capn12 UTSW 7 28892723 missense possibly damaging 0.66
R4793:Capn12 UTSW 7 28892669 missense probably benign 0.23
R4983:Capn12 UTSW 7 28890370 missense probably benign 0.00
R5560:Capn12 UTSW 7 28882860 missense probably benign 0.01
R5886:Capn12 UTSW 7 28887605 missense probably benign 0.01
R6247:Capn12 UTSW 7 28888652 missense probably benign 0.05
R6441:Capn12 UTSW 7 28888002 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCTGTGTGCCCAGAGTGTC -3'
(R):5'- CTCAGACCCAAGAGTTCAGG -3'

Sequencing Primer
(F):5'- AGGAAGGTCACCATCCAGCTG -3'
(R):5'- AAGAGTTCAGGCCCTGGTC -3'
Posted On2017-12-01