Incidental Mutation 'R5825:Traf3'
ID501606
Institutional Source Beutler Lab
Gene Symbol Traf3
Ensembl Gene ENSMUSG00000021277
Gene NameTNF receptor-associated factor 3
SynonymsLAP1, CRAF1, CD40bp, CAP-1
MMRRC Submission 044053-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5825 (G1)
Quality Score154
Status Not validated
Chromosome12
Chromosomal Location111166370-111267153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 111255361 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 319 (Q319K)
Ref Sequence ENSEMBL: ENSMUSP00000021706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021706] [ENSMUST00000060274] [ENSMUST00000117269]
PDB Structure
Crystal structure of TRAF3/Cardif [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000021706
AA Change: Q319K

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000021706
Gene: ENSMUSG00000021277
AA Change: Q319K

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 4.6e-18 PFAM
Pfam:zf-TRAF 191 250 9.9e-14 PFAM
coiled coil region 298 337 N/A INTRINSIC
MATH 419 542 5.69e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060274
AA Change: Q294K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000058361
Gene: ENSMUSG00000021277
AA Change: Q294K

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117269
AA Change: Q294K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112517
Gene: ENSMUSG00000021277
AA Change: Q294K

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143395
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 83.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. This protein participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. This protein is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-kappaB activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein-1 (LMP1) can interact with this and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. Several alternatively spliced transcript variants encoding three distinct isoforms have been reported. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mutation of this gene results in progressive runting, hypoglycemia, and depletion of peripheral white blood cells, leading to death by 10 days of age. Immune responses to T-dependent antigen are impaired in lethally irradiated mice reconstituted with mutant cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A T 15: 60,920,127 Y217* probably null Het
Abca2 A T 2: 25,436,736 I567F probably benign Het
Acss2 T A 2: 155,549,178 probably null Het
Atxn7l2 C A 3: 108,204,811 A320S probably damaging Het
Bfsp1 C T 2: 143,827,459 G400D probably benign Het
Ces5a G T 8: 93,525,667 A199D probably damaging Het
Chd2 A T 7: 73,484,602 probably null Het
Crebbp A G 16: 4,087,742 V1705A probably damaging Het
Cyp2j8 T A 4: 96,507,214 Q58L probably benign Het
Dlec1 T A 9: 119,142,968 I1379N probably damaging Het
Dnah9 T C 11: 66,126,601 H593R probably benign Het
Ep300 T A 15: 81,611,472 C412S probably benign Het
Fam110a A G 2: 151,970,041 S270P probably damaging Het
Gcc2 A G 10: 58,294,821 T1412A probably damaging Het
Gm4788 T A 1: 139,774,598 probably null Het
Helz2 T C 2: 181,232,656 E2015G probably benign Het
Hormad1 T C 3: 95,562,559 V39A probably damaging Het
Igf2 G T 7: 142,653,855 H168Q probably damaging Het
Il18rap A G 1: 40,531,566 T223A probably benign Het
Itpr2 T C 6: 146,144,149 E2573G probably damaging Het
Jcad T A 18: 4,674,896 V886E probably benign Het
Klra1 T C 6: 130,380,629 R12G probably damaging Het
Lamb1 A G 12: 31,318,614 I1248V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk7 C T 11: 61,490,381 R465Q possibly damaging Het
Mogs T C 6: 83,118,212 V670A possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Ninl A T 2: 150,940,724 I1182N probably damaging Het
Nup160 A G 2: 90,679,770 probably null Het
Nynrin A G 14: 55,864,226 R451G probably benign Het
Olfr1126 A G 2: 87,457,450 D95G probably benign Het
Olfr190 T C 16: 59,074,661 I140V probably benign Het
Osbp A G 19: 11,970,721 T131A probably damaging Het
Pcdhga12 A C 18: 37,768,503 D796A possibly damaging Het
Pcdhgb8 G A 18: 37,762,236 V120I probably benign Het
Pdgfb A T 15: 79,997,668 V213E probably benign Het
Phldb2 T C 16: 45,763,097 M1013V probably benign Het
Pnmal1 A G 7: 16,961,095 S292G probably benign Het
Prrt4 A G 6: 29,177,183 S196P probably benign Het
Rap1gds1 T C 3: 138,955,375 M463V possibly damaging Het
Tmprss11g A T 5: 86,498,533 S58R probably damaging Het
Trappc8 C T 18: 20,873,920 V194M probably damaging Het
Tyw1 A G 5: 130,268,088 K182R probably damaging Het
Usp48 A G 4: 137,623,378 T585A probably benign Het
Xkr6 G T 14: 63,819,032 V387L probably benign Het
Yod1 T C 1: 130,719,006 W207R probably damaging Het
Zdhhc8 T C 16: 18,228,674 S63G probably null Het
Zfp827 A G 8: 79,179,016 E874G probably damaging Het
Zfy1 T A Y: 726,531 K411N possibly damaging Het
Other mutations in Traf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Traf3 APN 12 111239067 missense probably damaging 0.99
IGL02015:Traf3 APN 12 111252740 missense probably benign
IGL02318:Traf3 APN 12 111237597 missense probably benign
IGL02429:Traf3 APN 12 111243465 missense probably benign 0.19
IGL03088:Traf3 APN 12 111261843 missense probably damaging 0.99
bananasplit UTSW 12 111262036 missense probably damaging 1.00
han UTSW 12 111261576 missense probably damaging 1.00
Hulk UTSW 12 111261576 missense probably damaging 1.00
sundae UTSW 12 111255224 missense possibly damaging 0.80
R0023:Traf3 UTSW 12 111243478 nonsense probably null
R0143:Traf3 UTSW 12 111261576 missense probably damaging 1.00
R1453:Traf3 UTSW 12 111255323 missense probably damaging 0.96
R1507:Traf3 UTSW 12 111260760 missense probably benign 0.30
R1651:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R1714:Traf3 UTSW 12 111242473 missense probably benign 0.01
R1996:Traf3 UTSW 12 111260661 missense probably benign 0.21
R1997:Traf3 UTSW 12 111260661 missense probably benign 0.21
R3946:Traf3 UTSW 12 111255245 missense possibly damaging 0.91
R4477:Traf3 UTSW 12 111248602 missense probably benign 0.00
R4645:Traf3 UTSW 12 111261966 missense probably damaging 1.00
R4723:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R4820:Traf3 UTSW 12 111260770 missense possibly damaging 0.96
R5123:Traf3 UTSW 12 111243518 missense possibly damaging 0.52
R5775:Traf3 UTSW 12 111252728 missense possibly damaging 0.91
R5912:Traf3 UTSW 12 111255349 missense probably benign 0.01
R6611:Traf3 UTSW 12 111237640 missense possibly damaging 0.76
R6933:Traf3 UTSW 12 111255224 missense possibly damaging 0.80
X0052:Traf3 UTSW 12 111252736 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GGCTCCTTTTAAGATGCCAGTAG -3'
(R):5'- AGAAATGCCTGCCTCTGAGC -3'

Sequencing Primer
(F):5'- CTCCTTTTAAGATGCCAGTAGAAAGC -3'
(R):5'- TGCCTCTGAGCAACACCTC -3'
Posted On2017-12-01