Incidental Mutation 'R5887:Mmrn1'
ID501617
Institutional Source Beutler Lab
Gene Symbol Mmrn1
Ensembl Gene ENSMUSG00000054641
Gene Namemultimerin 1
Synonyms4921530G03Rik, Emilin4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5887 (G1)
Quality Score177
Status Not validated
Chromosome6
Chromosomal Location60924976-60989378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60987074 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1020 (V1020A)
Ref Sequence ENSEMBL: ENSMUSP00000119609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]
Predicted Effect probably benign
Transcript: ENSMUST00000129603
AA Change: V1020A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: V1020A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 3.3e-12 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1026 1059 1.62e-5 SMART
C1Q 1076 1210 6.74e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204333
SMART Domains Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 7.7e-13 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1025 1058 1.62e-5 SMART
C1Q 1075 1209 6.74e-49 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,915,143 Q129* probably null Het
Acad8 A T 9: 26,979,324 probably null Het
AK157302 T C 13: 21,495,409 I35T possibly damaging Het
Arfgef3 G T 10: 18,607,665 S1437* probably null Het
Calcrl A T 2: 84,370,497 W68R probably damaging Het
Cd59a A G 2: 104,104,201 R5G probably damaging Het
Chl1 C T 6: 103,717,604 A1091V probably benign Het
Copg1 T C 6: 87,902,297 F442L probably damaging Het
Creld1 T C 6: 113,492,899 *421Q probably null Het
Crocc2 T A 1: 93,194,116 H662Q possibly damaging Het
Csf2ra G A 19: 61,227,328 A13V possibly damaging Het
Cul3 T C 1: 80,276,422 T546A possibly damaging Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Dock6 T A 9: 21,820,394 H1173L probably damaging Het
Dpysl4 T C 7: 139,096,276 I328T possibly damaging Het
Dspp G A 5: 104,175,455 G155R probably damaging Het
Fam208a T A 14: 27,466,297 L900* probably null Het
Fbxo33 A T 12: 59,204,759 C57* probably null Het
Frrs1 T A 3: 116,896,750 V14D probably benign Het
Gm13199 C T 2: 5,862,302 G96S unknown Het
Gm609 T A 16: 45,417,916 L178F probably damaging Het
Gpr155 A T 2: 73,343,718 C754* probably null Het
Gpr62 A T 9: 106,465,615 V38E probably damaging Het
Kcnt2 C A 1: 140,425,366 P271H probably damaging Het
Kpna3 C T 14: 61,403,012 V34I probably benign Het
Lamb1 C T 12: 31,266,864 Q71* probably null Het
Lipk T C 19: 34,039,107 I245T possibly damaging Het
Lrp1b T G 2: 40,821,707 N3281T possibly damaging Het
Lrp5 A C 19: 3,604,094 I1111S probably benign Het
Olfr1212 G A 2: 88,958,754 C96Y possibly damaging Het
Olfr912 G A 9: 38,581,784 C169Y probably damaging Het
Olfr954 T C 9: 39,461,491 L17P probably damaging Het
Pcdha7 A T 18: 36,975,907 T662S probably damaging Het
Pcdhga6 A G 18: 37,708,559 D444G probably damaging Het
Pkd2 T G 5: 104,498,539 D737E probably damaging Het
Plcd4 C T 1: 74,551,090 R161W probably damaging Het
Prpf8 A G 11: 75,500,908 Y1494C possibly damaging Het
Rad17 A C 13: 100,633,861 probably null Het
Rbm17 A T 2: 11,585,674 F390Y probably damaging Het
Rhod A T 19: 4,439,287 L22Q probably damaging Het
Serpina1f T C 12: 103,689,787 D394G possibly damaging Het
Serpina1f G A 12: 103,693,631 Q131* probably null Het
Spocd1 A T 4: 129,948,959 S56C probably damaging Het
St7l G A 3: 104,874,928 R207H probably benign Het
Tbx18 T C 9: 87,713,513 D336G possibly damaging Het
Tfg A T 16: 56,694,416 Y135* probably null Het
Tjp2 A G 19: 24,096,599 L1108P probably benign Het
Tmem150c C A 5: 100,095,665 V8L probably benign Het
Ttn A T 2: 76,916,445 H4753Q probably benign Het
Tyw1 T A 5: 130,325,699 I589N probably damaging Het
Usp40 C T 1: 87,999,870 R139Q probably damaging Het
Zgrf1 A G 3: 127,584,765 Y174C probably damaging Het
Other mutations in Mmrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Mmrn1 APN 6 60977513 missense probably benign
IGL00742:Mmrn1 APN 6 60958120 missense probably damaging 1.00
IGL00917:Mmrn1 APN 6 60975910 nonsense probably null
IGL01121:Mmrn1 APN 6 60975944 missense possibly damaging 0.46
IGL01393:Mmrn1 APN 6 60960708 splice site probably benign
IGL01697:Mmrn1 APN 6 60976493 missense possibly damaging 0.46
IGL01737:Mmrn1 APN 6 60977161 missense probably benign
IGL01944:Mmrn1 APN 6 60971183 critical splice donor site probably null
IGL01987:Mmrn1 APN 6 60944573 missense probably benign 0.31
IGL02005:Mmrn1 APN 6 60960744 missense probably damaging 1.00
IGL02190:Mmrn1 APN 6 60987193 missense probably benign 0.13
IGL02335:Mmrn1 APN 6 60977147 missense possibly damaging 0.79
IGL02421:Mmrn1 APN 6 60944822 missense probably benign 0.00
IGL02530:Mmrn1 APN 6 60958176 missense possibly damaging 0.73
IGL02709:Mmrn1 APN 6 60973046 missense probably damaging 1.00
IGL03139:Mmrn1 APN 6 60976340 missense probably damaging 0.99
IGL03228:Mmrn1 APN 6 60944892 missense probably benign 0.02
IGL03272:Mmrn1 APN 6 60988435 missense probably damaging 1.00
IGL03410:Mmrn1 APN 6 60975835 missense probably benign 0.36
H8562:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
K2124:Mmrn1 UTSW 6 60976033 missense possibly damaging 0.87
R0145:Mmrn1 UTSW 6 60973010 missense probably damaging 1.00
R0164:Mmrn1 UTSW 6 60975815 splice site probably benign
R0352:Mmrn1 UTSW 6 60944971 missense probably benign 0.03
R0400:Mmrn1 UTSW 6 60977115 missense probably benign 0.00
R0538:Mmrn1 UTSW 6 60976469 missense probably benign 0.00
R0907:Mmrn1 UTSW 6 60973119 missense probably benign 0.09
R1117:Mmrn1 UTSW 6 60976325 missense possibly damaging 0.51
R1383:Mmrn1 UTSW 6 60976322 missense probably damaging 1.00
R1542:Mmrn1 UTSW 6 60945118 missense probably damaging 0.98
R1591:Mmrn1 UTSW 6 60944771 nonsense probably null
R1599:Mmrn1 UTSW 6 60945037 missense probably benign
R1733:Mmrn1 UTSW 6 60977101 missense probably benign 0.00
R2005:Mmrn1 UTSW 6 60976084 missense possibly damaging 0.88
R2056:Mmrn1 UTSW 6 60944805 missense probably benign 0.00
R2144:Mmrn1 UTSW 6 60945075 missense possibly damaging 0.54
R2299:Mmrn1 UTSW 6 60976441 missense probably damaging 0.99
R3836:Mmrn1 UTSW 6 60944847 missense probably benign
R3837:Mmrn1 UTSW 6 60944847 missense probably benign
R4206:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
R4414:Mmrn1 UTSW 6 60944586 missense probably damaging 1.00
R4590:Mmrn1 UTSW 6 60960813 missense probably damaging 1.00
R4707:Mmrn1 UTSW 6 60988473 missense probably benign 0.12
R4820:Mmrn1 UTSW 6 60973043 missense probably benign 0.04
R4880:Mmrn1 UTSW 6 60976439 missense probably benign 0.15
R5166:Mmrn1 UTSW 6 60976490 missense probably benign 0.04
R5324:Mmrn1 UTSW 6 60976586 missense probably damaging 1.00
R5917:Mmrn1 UTSW 6 60973150 critical splice donor site probably null
R6108:Mmrn1 UTSW 6 60975976 missense possibly damaging 0.83
R6539:Mmrn1 UTSW 6 60987184 missense probably benign 0.01
R6996:Mmrn1 UTSW 6 60977383 missense probably benign 0.04
R7064:Mmrn1 UTSW 6 60988540 nonsense probably null
R7073:Mmrn1 UTSW 6 60988427 missense not run
X0026:Mmrn1 UTSW 6 60976013 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGTTTTGCATGAATACCCTCCC -3'
(R):5'- GTATGTCCAGCATGTGTTCGC -3'

Sequencing Primer
(F):5'- TGCATGAATACCCTCCCTAATGG -3'
(R):5'- ATGTGTTCGCGCGTGACAC -3'
Posted On2017-12-01