Incidental Mutation 'R5895:Fbxl4'
ID501628
Institutional Source Beutler Lab
Gene Symbol Fbxl4
Ensembl Gene ENSMUSG00000040410
Gene NameF-box and leucine-rich repeat protein 4
SynonymsFBL5, FBL4
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R5895 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location22357543-22434091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22390678 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 287 (L287P)
Ref Sequence ENSEMBL: ENSMUSP00000138825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039234] [ENSMUST00000184455] [ENSMUST00000184582] [ENSMUST00000185029]
Predicted Effect probably damaging
Transcript: ENSMUST00000039234
AA Change: L287P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042219
Gene: ENSMUSG00000040410
AA Change: L287P

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-6 BLAST
LRR 400 425 1.95e-3 SMART
LRR 450 475 1.01e-1 SMART
LRR_CC 478 503 4.14e-7 SMART
LRR 504 524 1.16e2 SMART
LRR 532 557 3.69e1 SMART
LRR 558 583 8.71e0 SMART
LRR 584 609 1.64e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184455
Predicted Effect probably damaging
Transcript: ENSMUST00000184582
AA Change: L287P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139158
Gene: ENSMUSG00000040410
AA Change: L287P

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-6 BLAST
LRR 400 425 1.95e-3 SMART
LRR 450 475 1.01e-1 SMART
LRR_CC 478 503 4.14e-7 SMART
LRR 504 524 1.16e2 SMART
LRR 532 557 3.69e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185029
AA Change: L287P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138825
Gene: ENSMUSG00000040410
AA Change: L287P

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-7 BLAST
Blast:LRR 400 425 2e-9 BLAST
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.7%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, which are characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one subunit of modular E3 ubiquitin ligase complexes, called SCF complexes, which function in phosphorylation-dependent ubiquitination. The F-box domain mediates protein-protein interactions and binds directly to S-phase kinase-associated protein 1. In addition to an F-box domain, the encoded protein contains at least 9 tandem leucine-rich repeats. The ubiquitin ligase complex containing the encoded protein may function in cell-cycle control by regulating levels of lysine-specific demethylase 4A. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,759,617 T249A probably benign Het
Abcb1a G A 5: 8,702,216 G426S probably damaging Het
Casp4 A T 9: 5,328,573 probably benign Het
Ccdc40 T A 11: 119,253,403 F988Y probably damaging Het
Chd5 T A 4: 152,379,932 V1516E probably benign Het
Chrnd T A 1: 87,195,667 probably null Het
Col5a3 C A 9: 20,772,442 G1506V unknown Het
Csgalnact2 A T 6: 118,129,254 C34* probably null Het
Ddx23 T C 15: 98,651,951 K195E probably benign Het
Dhps T G 8: 85,074,251 S240A probably benign Het
Dnah5 T A 15: 28,234,453 probably null Het
Dock10 T C 1: 80,536,959 T1414A probably benign Het
Dock4 A G 12: 40,755,813 D928G probably damaging Het
Dolpp1 T C 2: 30,395,646 probably benign Het
Dse T A 10: 34,152,605 I830F probably damaging Het
Elmod1 C T 9: 53,935,807 R29Q probably damaging Het
Ephx4 T A 5: 107,429,652 probably null Het
Evi5 A T 5: 107,820,436 M215K probably damaging Het
Gbp9 G A 5: 105,082,858 S400L probably damaging Het
Gm6291 T C 18: 6,371,365 noncoding transcript Het
Gmcl1 A T 6: 86,711,614 D301E probably benign Het
Gna14 C T 19: 16,603,328 R177C possibly damaging Het
Golph3 C T 15: 12,339,670 R90C probably damaging Het
Gpr142 T A 11: 114,798,959 C12* probably null Het
Hat1 T A 2: 71,409,013 N43K possibly damaging Het
Hivep1 A T 13: 42,157,218 E978V possibly damaging Het
Hormad1 G A 3: 95,559,733 probably null Het
Kalrn C T 16: 33,975,435 probably benign Het
Mars T C 10: 127,296,549 T860A probably benign Het
Mdn1 A T 4: 32,695,400 L1146F probably damaging Het
Met A G 6: 17,531,582 T620A probably benign Het
Mppe1 T C 18: 67,225,763 E378G probably benign Het
Mybpc3 T A 2: 91,124,665 V481D probably damaging Het
Myh14 A T 7: 44,606,709 L1924Q probably damaging Het
Mylip G T 13: 45,408,702 E327* probably null Het
Naip1 C T 13: 100,423,128 G1123R probably benign Het
Naip6 A G 13: 100,315,992 V187A possibly damaging Het
Ncam1 T A 9: 49,507,043 T986S probably benign Het
Olfr1274-ps T C 2: 90,401,456 I265T probably benign Het
Olfr1342 T C 4: 118,690,117 I112V probably damaging Het
Phactr2 C T 10: 13,245,517 G480S probably damaging Het
Por A G 5: 135,715,984 I34V probably benign Het
Ppp2r5b C T 19: 6,234,734 R33H probably damaging Het
Prkdc C A 16: 15,752,829 Y2325* probably null Het
Prx A G 7: 27,515,284 E73G probably damaging Het
Rbms2 C A 10: 128,145,687 A126S possibly damaging Het
Rhoq C T 17: 86,994,689 A111V probably damaging Het
Rpl14 T A 9: 120,574,174 probably benign Het
Serbp1 A G 6: 67,272,886 *75W probably null Het
Sptbn1 C A 11: 30,123,978 V1351F probably damaging Het
Supt16 A G 14: 52,164,522 V897A probably benign Het
Tfdp1 T A 8: 13,357,038 probably null Het
Ttn T A 2: 76,950,143 Y1088F probably damaging Het
Vmn2r105 G T 17: 20,228,667 Q83K probably benign Het
Wdr76 A T 2: 121,528,842 S221C probably damaging Het
Zfhx2 G T 14: 55,065,891 F1545L probably benign Het
Zfp318 A G 17: 46,399,033 I561V probably damaging Het
Other mutations in Fbxl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Fbxl4 APN 4 22427348 missense probably benign 0.01
IGL01973:Fbxl4 APN 4 22422766 missense probably damaging 1.00
IGL02353:Fbxl4 APN 4 22433684 missense probably benign 0.00
IGL02360:Fbxl4 APN 4 22433684 missense probably benign 0.00
IGL02871:Fbxl4 APN 4 22386213 missense probably benign
R0033:Fbxl4 UTSW 4 22377017 missense probably damaging 1.00
R0379:Fbxl4 UTSW 4 22386106 missense probably benign 0.01
R1053:Fbxl4 UTSW 4 22427166 missense probably benign
R1527:Fbxl4 UTSW 4 22386154 missense probably benign 0.00
R1768:Fbxl4 UTSW 4 22385950 missense probably benign 0.00
R2148:Fbxl4 UTSW 4 22427333 missense possibly damaging 0.65
R2196:Fbxl4 UTSW 4 22403624 missense probably benign
R2850:Fbxl4 UTSW 4 22403624 missense probably benign
R4024:Fbxl4 UTSW 4 22377074 missense possibly damaging 0.83
R4425:Fbxl4 UTSW 4 22422699 intron probably null
R5227:Fbxl4 UTSW 4 22376840 missense probably damaging 1.00
R5499:Fbxl4 UTSW 4 22386017 missense probably damaging 1.00
R5595:Fbxl4 UTSW 4 22433641 missense probably damaging 1.00
R6475:Fbxl4 UTSW 4 22433661 missense probably damaging 1.00
R6697:Fbxl4 UTSW 4 22376599 missense probably benign 0.33
R6977:Fbxl4 UTSW 4 22376930 missense probably benign 0.22
R7164:Fbxl4 UTSW 4 22386218 missense probably benign 0.00
R7264:Fbxl4 UTSW 4 22386145 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCAGTGCGTATATCTTTGTGC -3'
(R):5'- ACAGATTAAGCCACTGGACAAG -3'

Sequencing Primer
(F):5'- AAATGCGATCTAATGTATGTGTTGG -3'
(R):5'- GATTAAGCCACTGGACAAGCACAC -3'
Posted On2017-12-01