Incidental Mutation 'R5902:4932414N04Rik'
ID501636
Institutional Source Beutler Lab
Gene Symbol 4932414N04Rik
Ensembl Gene ENSMUSG00000079324
Gene NameRIKEN cDNA 4932414N04 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5902 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location68656486-68748467 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 68708937 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000135792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055930] [ENSMUST00000128259]
Predicted Effect probably null
Transcript: ENSMUST00000055930
AA Change: M1V
SMART Domains Protein: ENSMUSP00000059809
Gene: ENSMUSG00000079324
AA Change: M1V

DomainStartEndE-ValueType
coiled coil region 154 241 N/A INTRINSIC
Pfam:DUF3496 265 361 8.5e-12 PFAM
internal_repeat_1 456 597 1.76e-26 PROSPERO
internal_repeat_1 601 737 1.76e-26 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000128259
AA Change: M1V
SMART Domains Protein: ENSMUSP00000135792
Gene: ENSMUSG00000079324
AA Change: M1V

DomainStartEndE-ValueType
internal_repeat_1 5 39 6.02e-5 PROSPERO
internal_repeat_1 209 242 6.02e-5 PROSPERO
low complexity region 286 297 N/A INTRINSIC
Meta Mutation Damage Score 0.6372 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.1%
Validation Efficiency 99% (81/82)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,297,177 L2308H probably damaging Het
Abcc8 T C 7: 46,115,039 T1161A probably benign Het
Acin1 T A 14: 54,663,673 T659S probably benign Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Alkbh8 A G 9: 3,385,414 K569E probably benign Het
Anxa3 A T 5: 96,812,853 K39* probably null Het
Aoc2 A G 11: 101,329,246 E659G probably damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
AU022252 T C 4: 119,226,904 D104G probably benign Het
Car6 T C 4: 150,187,499 Y231C possibly damaging Het
Ccdc94 A G 17: 55,962,077 T62A probably damaging Het
Cdh10 T G 15: 18,985,255 probably null Het
Cebpz A C 17: 78,925,937 M787R probably benign Het
Chst2 A G 9: 95,405,609 L228P probably damaging Het
Clic4 T C 4: 135,272,558 K11R probably benign Het
Col6a3 C T 1: 90,802,199 probably null Het
Commd7 T A 2: 153,621,817 T144S probably damaging Het
Ctla2a T A 13: 60,935,020 *138Y probably null Het
Dhx33 A T 11: 70,989,131 V351D probably damaging Het
Dnah9 G A 11: 66,025,187 T2313I probably benign Het
Dspp A T 5: 104,178,111 D780V unknown Het
Dync1li1 A G 9: 114,717,861 probably null Het
E2f3 C T 13: 29,985,267 probably benign Het
Fan1 T C 7: 64,373,322 probably null Het
Gart A G 16: 91,628,527 S617P probably damaging Het
Ggcx A G 6: 72,429,996 N705S possibly damaging Het
Gm4841 A T 18: 60,270,796 V75E probably damaging Het
Greb1l A G 18: 10,538,302 E1105G probably benign Het
Hr C A 14: 70,557,791 Q288K probably benign Het
Hus1 T C 11: 9,010,669 probably benign Het
Ifi47 C A 11: 49,095,386 probably null Het
Irf2bp1 T C 7: 19,004,447 V4A probably benign Het
Kprp C T 3: 92,824,528 C405Y unknown Het
Lacc1 T C 14: 77,034,799 I186V possibly damaging Het
Lifr A G 15: 7,190,750 T954A probably benign Het
Lonrf2 T C 1: 38,807,093 M333V probably benign Het
Mthfd1 A T 12: 76,291,052 H400L probably benign Het
Myh4 A G 11: 67,250,907 K864R possibly damaging Het
Nup50 C T 15: 84,935,440 A305V probably benign Het
Olfr1247 T A 2: 89,609,251 I284L probably damaging Het
Olfr1294 C T 2: 111,537,394 M298I probably benign Het
Pax4 G T 6: 28,447,127 Q3K probably benign Het
Pced1b T G 15: 97,385,089 Y336* probably null Het
Postn C A 3: 54,372,089 N329K probably benign Het
Prickle1 T C 15: 93,510,672 E82G probably null Het
Prtn3 T C 10: 79,882,932 Y241H probably damaging Het
Rasgrf2 A T 13: 91,919,892 I260K probably damaging Het
Sh3glb1 T C 3: 144,712,670 N44S possibly damaging Het
Sis A T 3: 72,960,256 probably null Het
Slc4a9 A G 18: 36,529,333 probably null Het
Slc4a9 A T 18: 36,531,507 D406V probably damaging Het
Slc8a1 C T 17: 81,408,082 G841R probably damaging Het
Smn1 C T 13: 100,126,904 P60L probably benign Het
Snai1 G A 2: 167,542,010 C241Y probably damaging Het
Spock3 A G 8: 63,355,302 D411G unknown Het
Szt2 T A 4: 118,391,503 T607S probably benign Het
Tcap A T 11: 98,383,847 M1L probably benign Het
Tex29 C A 8: 11,854,276 probably benign Het
Tex29 C T 8: 11,854,277 probably benign Het
Tex29 A T 8: 11,855,723 probably benign Het
Tln2 T C 9: 67,362,717 T467A probably benign Het
Trim34a C T 7: 104,261,121 Q377* probably null Het
Ube2q1 T A 3: 89,776,180 L144* probably null Het
Vps13c A G 9: 67,934,447 E1917G probably benign Het
Wdr19 T A 5: 65,227,139 N525K probably benign Het
Wdr3 A T 3: 100,144,491 probably benign Het
Wnt5b T A 6: 119,448,238 H6L probably benign Het
Zdbf2 T C 1: 63,306,526 S1355P possibly damaging Het
Zfp11 T A 5: 129,657,912 I162F probably damaging Het
Zpbp T C 11: 11,415,332 T172A probably benign Het
Other mutations in 4932414N04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:4932414N04Rik APN 2 68732875 missense probably benign 0.02
IGL01384:4932414N04Rik APN 2 68745405 missense possibly damaging 0.53
IGL02170:4932414N04Rik APN 2 68731123 missense probably benign 0.02
IGL02650:4932414N04Rik APN 2 68741537 missense probably benign 0.00
IGL02707:4932414N04Rik APN 2 68731130 missense possibly damaging 0.71
IGL02737:4932414N04Rik APN 2 68736560 missense possibly damaging 0.53
IGL03351:4932414N04Rik APN 2 68731083 missense probably benign
R0328:4932414N04Rik UTSW 2 68744280 missense possibly damaging 0.53
R0362:4932414N04Rik UTSW 2 68732917 missense probably benign 0.00
R0638:4932414N04Rik UTSW 2 68717228 missense probably benign 0.18
R1201:4932414N04Rik UTSW 2 68716282 missense possibly damaging 0.53
R1381:4932414N04Rik UTSW 2 68731086 missense probably benign 0.18
R1456:4932414N04Rik UTSW 2 68716214 missense possibly damaging 0.86
R2001:4932414N04Rik UTSW 2 68741456 missense probably benign
R2051:4932414N04Rik UTSW 2 68711048 missense possibly damaging 0.72
R2228:4932414N04Rik UTSW 2 68729591 missense probably benign 0.00
R2292:4932414N04Rik UTSW 2 68732139 missense probably benign 0.00
R2357:4932414N04Rik UTSW 2 68739500 missense possibly damaging 0.86
R2484:4932414N04Rik UTSW 2 68711475 missense possibly damaging 0.85
R3035:4932414N04Rik UTSW 2 68745418 missense probably benign 0.00
R3916:4932414N04Rik UTSW 2 68731985 missense possibly damaging 0.71
R3950:4932414N04Rik UTSW 2 68664403 critical splice donor site probably null
R3951:4932414N04Rik UTSW 2 68664403 critical splice donor site probably null
R3952:4932414N04Rik UTSW 2 68664403 critical splice donor site probably null
R4091:4932414N04Rik UTSW 2 68745378 missense possibly damaging 0.73
R4118:4932414N04Rik UTSW 2 68736513 missense probably benign
R4153:4932414N04Rik UTSW 2 68668597 intron probably benign
R4210:4932414N04Rik UTSW 2 68659878 start gained probably benign
R4614:4932414N04Rik UTSW 2 68745460 missense probably benign 0.01
R4818:4932414N04Rik UTSW 2 68741466 missense probably benign
R5202:4932414N04Rik UTSW 2 68731964 missense probably benign
R5466:4932414N04Rik UTSW 2 68711389 missense probably benign 0.11
R5585:4932414N04Rik UTSW 2 68741426 missense probably benign 0.00
R5602:4932414N04Rik UTSW 2 68748368 makesense probably null
R5846:4932414N04Rik UTSW 2 68732033 missense unknown
R6002:4932414N04Rik UTSW 2 68662424 splice site probably null
R6029:4932414N04Rik UTSW 2 68694026 splice site probably null
R6093:4932414N04Rik UTSW 2 68659870 splice site probably benign
R6168:4932414N04Rik UTSW 2 68741483 missense possibly damaging 0.86
R6300:4932414N04Rik UTSW 2 68731109 missense possibly damaging 0.96
R6322:4932414N04Rik UTSW 2 68729499 missense probably benign 0.00
R6533:4932414N04Rik UTSW 2 68716318 nonsense probably null
R6547:4932414N04Rik UTSW 2 68659907 utr 5 prime probably benign
X0025:4932414N04Rik UTSW 2 68729016 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGTATGGAGAGCTGTAGCAC -3'
(R):5'- TCTCTAAGTTGAGAACACCTATGTG -3'

Sequencing Primer
(F):5'- AGAAACCTGAAGGATCCTGTC -3'
(R):5'- CACCTATGTGTACAATTAGAGTTCC -3'
Posted On2017-12-01