Incidental Mutation 'R5956:Trrap'
ID501667
Institutional Source Beutler Lab
Gene Symbol Trrap
Ensembl Gene ENSMUSG00000045482
Gene Nametransformation/transcription domain-associated protein
Synonymstransactivation/transformation-domain associated protein
MMRRC Submission 044144-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5956 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location144767732-144859778 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 144807391 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]
Predicted Effect silent
Transcript: ENSMUST00000038980
SMART Domains Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3363 3376 N/A INTRINSIC
low complexity region 3407 3418 N/A INTRINSIC
PI3Kc 3509 3798 5.11e-8 SMART
FATC 3797 3829 1.89e-3 SMART
Predicted Effect silent
Transcript: ENSMUST00000094120
SMART Domains Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1682 2e-6 SMART
low complexity region 1850 1861 N/A INTRINSIC
low complexity region 1884 1899 N/A INTRINSIC
low complexity region 2307 2321 N/A INTRINSIC
Pfam:FAT 2848 3203 1.1e-68 PFAM
low complexity region 3392 3405 N/A INTRINSIC
low complexity region 3436 3447 N/A INTRINSIC
PI3Kc 3538 3827 5.11e-8 SMART
FATC 3826 3858 1.89e-3 SMART
Predicted Effect silent
Transcript: ENSMUST00000100467
SMART Domains Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3381 3394 N/A INTRINSIC
low complexity region 3425 3436 N/A INTRINSIC
PI3Kc 3527 3816 5.11e-8 SMART
FATC 3815 3847 1.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132347
Predicted Effect silent
Transcript: ENSMUST00000132925
SMART Domains Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482

DomainStartEndE-ValueType
low complexity region 197 242 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
SCOP:d1gw5a_ 474 1003 9e-7 SMART
Blast:PI3Kc 480 579 1e-13 BLAST
low complexity region 1083 1092 N/A INTRINSIC
low complexity region 1572 1583 N/A INTRINSIC
low complexity region 1606 1621 N/A INTRINSIC
low complexity region 2029 2043 N/A INTRINSIC
Pfam:FAT 2570 2914 1.5e-69 PFAM
low complexity region 3121 3134 N/A INTRINSIC
low complexity region 3165 3176 N/A INTRINSIC
PI3Kc 3267 3556 5.11e-8 SMART
FATC 3555 3587 1.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197834
Predicted Effect silent
Transcript: ENSMUST00000213013
Meta Mutation Damage Score 0.6156 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,157,119 I398K possibly damaging Het
A530099J19Rik T G 13: 19,729,130 noncoding transcript Het
Acad9 A G 3: 36,075,174 probably benign Het
Acsm2 T C 7: 119,554,481 S5P unknown Het
Akp3 T C 1: 87,126,945 I334T probably damaging Het
Amy1 C T 3: 113,563,662 R176H probably benign Het
Ank2 A T 3: 126,942,688 probably benign Het
Cav1 C A 6: 17,307,919 N23K probably damaging Het
Cep126 A G 9: 8,112,119 V151A probably benign Het
Cnot1 A G 8: 95,754,978 probably null Het
Crim1 T A 17: 78,315,717 V448E probably damaging Het
Csmd3 T C 15: 48,791,882 E8G possibly damaging Het
Ddx31 A T 2: 28,874,173 I464F probably damaging Het
Ddx54 A G 5: 120,626,367 probably benign Het
Dhx16 A G 17: 35,882,870 E319G probably damaging Het
Efl1 A G 7: 82,651,899 D37G probably damaging Het
Epha5 T C 5: 84,150,369 R444G probably damaging Het
Exoc2 C A 13: 30,820,623 C859F probably benign Het
Gbx2 T C 1: 89,933,186 probably benign Het
Gm12258 G A 11: 58,859,459 A9T probably benign Het
Gm1966 T C 7: 106,601,470 noncoding transcript Het
Grm4 A G 17: 27,435,155 V607A probably benign Het
Ighv1-74 C A 12: 115,802,835 W55L probably damaging Het
Irx4 C A 13: 73,267,507 Y138* probably null Het
Itpr1 C A 6: 108,506,027 T2352K probably benign Het
Kcnk3 T G 5: 30,588,510 V65G probably damaging Het
Mctp2 T C 7: 72,259,175 E130G probably benign Het
Mgat5 C A 1: 127,382,939 R197S probably benign Het
Mpg T C 11: 32,227,951 probably null Het
Muc5b T C 7: 141,864,173 C3619R probably damaging Het
Myo15b G A 11: 115,873,757 V1321I probably benign Het
Myo1b T C 1: 51,776,232 T658A probably damaging Het
Nomo1 T C 7: 46,042,613 S154P possibly damaging Het
Nsd1 T A 13: 55,263,404 F1423I probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1012 A G 2: 85,753,839 probably benign Het
Osbpl6 A G 2: 76,549,512 R149G probably damaging Het
Papola T A 12: 105,811,041 W281R probably damaging Het
Pole C T 5: 110,337,287 probably benign Het
Rptn A G 3: 93,398,027 N889S possibly damaging Het
Scn10a A G 9: 119,631,560 S1084P probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Siglece T C 7: 43,659,336 T198A probably damaging Het
Sptb T A 12: 76,604,168 M1678L probably benign Het
Taf8 A T 17: 47,498,542 M98K probably damaging Het
Tead2 T A 7: 45,220,714 probably benign Het
Tmem206 A G 1: 191,348,371 S263G probably damaging Het
Ttn G T 2: 76,945,570 N1709K probably damaging Het
Ube3a T C 7: 59,277,020 probably benign Het
Ube3c T C 5: 29,599,056 probably benign Het
Unc80 T C 1: 66,527,964 S910P probably damaging Het
Usp30 G A 5: 114,119,621 R280Q possibly damaging Het
Vsx1 T C 2: 150,688,537 S142G possibly damaging Het
Wdr95 T G 5: 149,594,482 C360G probably benign Het
Zbtb4 A G 11: 69,778,214 I588V probably benign Het
Zdhhc4 A T 5: 143,324,849 probably benign Het
Zfp568 C A 7: 29,997,863 N69K probably damaging Het
Other mutations in Trrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Trrap APN 5 144779974 splice site probably benign
IGL00470:Trrap APN 5 144818038 missense probably damaging 1.00
IGL00490:Trrap APN 5 144825225 missense probably benign 0.40
IGL01072:Trrap APN 5 144784255 splice site probably benign
IGL01087:Trrap APN 5 144846539 missense probably damaging 0.99
IGL01300:Trrap APN 5 144804818 missense probably damaging 1.00
IGL01350:Trrap APN 5 144830969 missense possibly damaging 0.92
IGL01410:Trrap APN 5 144831021 missense probably benign 0.00
IGL01571:Trrap APN 5 144833287 splice site probably benign
IGL01748:Trrap APN 5 144833340 missense probably damaging 1.00
IGL01839:Trrap APN 5 144821875 missense probably damaging 1.00
IGL01976:Trrap APN 5 144856989 missense probably benign 0.00
IGL02075:Trrap APN 5 144828494 missense probably benign 0.00
IGL02127:Trrap APN 5 144816433 missense probably benign 0.22
IGL02131:Trrap APN 5 144840436 missense probably damaging 1.00
IGL02287:Trrap APN 5 144832538 missense probably damaging 1.00
IGL02301:Trrap APN 5 144777917 missense probably benign 0.05
IGL02336:Trrap APN 5 144798390 missense probably benign 0.39
IGL02526:Trrap APN 5 144824550 missense probably benign 0.00
IGL02873:Trrap APN 5 144841079 splice site probably benign
IGL02953:Trrap APN 5 144815964 missense probably damaging 0.99
IGL03404:Trrap APN 5 144833186 missense probably benign 0.00
Card-tower UTSW 5 144804766 missense probably damaging 1.00
PIT4243001:Trrap UTSW 5 144796971 missense probably benign 0.00
PIT4466001:Trrap UTSW 5 144828600 missense probably benign 0.02
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0112:Trrap UTSW 5 144822761 nonsense probably null
R0126:Trrap UTSW 5 144805750 nonsense probably null
R0257:Trrap UTSW 5 144804235 missense probably benign 0.31
R0325:Trrap UTSW 5 144816395 missense probably benign 0.05
R0376:Trrap UTSW 5 144816339 missense probably benign 0.03
R0396:Trrap UTSW 5 144814556 missense probably damaging 0.99
R0448:Trrap UTSW 5 144839567 missense possibly damaging 0.66
R0454:Trrap UTSW 5 144846477 missense probably damaging 1.00
R0711:Trrap UTSW 5 144853499 missense probably damaging 1.00
R0827:Trrap UTSW 5 144814830 missense probably benign 0.00
R1005:Trrap UTSW 5 144805727 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1179:Trrap UTSW 5 144777939 missense possibly damaging 0.94
R1218:Trrap UTSW 5 144816409 missense probably damaging 1.00
R1264:Trrap UTSW 5 144789599 splice site probably benign
R1374:Trrap UTSW 5 144846618 missense probably damaging 1.00
R1401:Trrap UTSW 5 144857422 missense possibly damaging 0.93
R1480:Trrap UTSW 5 144818313 missense probably benign
R1538:Trrap UTSW 5 144837202 missense possibly damaging 0.65
R1751:Trrap UTSW 5 144814575 critical splice donor site probably null
R1779:Trrap UTSW 5 144828590 missense probably benign 0.01
R1782:Trrap UTSW 5 144822703 missense possibly damaging 0.93
R1792:Trrap UTSW 5 144853586 missense possibly damaging 0.87
R1859:Trrap UTSW 5 144830951 missense probably benign 0.04
R1861:Trrap UTSW 5 144815917 splice site probably null
R1902:Trrap UTSW 5 144816053 missense probably damaging 1.00
R1903:Trrap UTSW 5 144816053 missense probably damaging 1.00
R2021:Trrap UTSW 5 144853488 missense possibly damaging 0.94
R2026:Trrap UTSW 5 144803044 missense possibly damaging 0.86
R2036:Trrap UTSW 5 144828562 missense probably benign 0.08
R2099:Trrap UTSW 5 144782239 missense possibly damaging 0.46
R2108:Trrap UTSW 5 144825874 missense probably benign 0.01
R2113:Trrap UTSW 5 144844211 missense probably damaging 1.00
R2174:Trrap UTSW 5 144821855 missense probably benign 0.40
R2442:Trrap UTSW 5 144817966 missense probably damaging 1.00
R2568:Trrap UTSW 5 144843369 critical splice donor site probably null
R3442:Trrap UTSW 5 144792252 missense probably benign 0.03
R3853:Trrap UTSW 5 144792165 missense probably damaging 1.00
R4401:Trrap UTSW 5 144843318 missense possibly damaging 0.60
R4493:Trrap UTSW 5 144831048 missense probably benign 0.21
R4524:Trrap UTSW 5 144825321 missense probably benign 0.38
R4569:Trrap UTSW 5 144792118 missense probably benign 0.13
R4672:Trrap UTSW 5 144785480 missense probably damaging 0.97
R4732:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4733:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4791:Trrap UTSW 5 144803277 missense probably damaging 1.00
R4795:Trrap UTSW 5 144832488 missense probably benign 0.06
R4827:Trrap UTSW 5 144800948 missense probably benign 0.02
R4839:Trrap UTSW 5 144845592 missense probably damaging 1.00
R4915:Trrap UTSW 5 144805735 missense probably damaging 0.99
R4951:Trrap UTSW 5 144805720 missense possibly damaging 0.65
R4959:Trrap UTSW 5 144856960 missense probably damaging 1.00
R5049:Trrap UTSW 5 144826717 missense probably damaging 1.00
R5074:Trrap UTSW 5 144851179 missense probably damaging 1.00
R5236:Trrap UTSW 5 144817786 missense probably benign 0.07
R5281:Trrap UTSW 5 144813503 missense probably benign 0.13
R5322:Trrap UTSW 5 144844224 missense probably damaging 1.00
R5457:Trrap UTSW 5 144849977 missense probably damaging 1.00
R5590:Trrap UTSW 5 144782265 missense probably benign 0.05
R5799:Trrap UTSW 5 144830945 missense probably benign
R5885:Trrap UTSW 5 144794793 missense probably damaging 1.00
R5905:Trrap UTSW 5 144849920 missense possibly damaging 0.95
R5908:Trrap UTSW 5 144786708 missense probably damaging 0.96
R5992:Trrap UTSW 5 144810184 missense probably benign 0.00
R6017:Trrap UTSW 5 144844241 missense probably damaging 1.00
R6029:Trrap UTSW 5 144817679 missense possibly damaging 0.94
R6029:Trrap UTSW 5 144825914 missense possibly damaging 0.75
R6117:Trrap UTSW 5 144802961 missense possibly damaging 0.78
R6166:Trrap UTSW 5 144781981 missense possibly damaging 0.66
R6234:Trrap UTSW 5 144839713 intron probably null
R6288:Trrap UTSW 5 144811992 missense probably damaging 1.00
R6290:Trrap UTSW 5 144805018 missense probably damaging 1.00
R6316:Trrap UTSW 5 144813526 missense probably benign 0.02
R6398:Trrap UTSW 5 144790870 missense possibly damaging 0.83
R6413:Trrap UTSW 5 144784046 missense possibly damaging 0.83
R6499:Trrap UTSW 5 144857002 missense probably damaging 1.00
R6529:Trrap UTSW 5 144834204 missense probably benign 0.06
R6574:Trrap UTSW 5 144815550 critical splice donor site probably null
R6631:Trrap UTSW 5 144771650 missense possibly damaging 0.94
R6727:Trrap UTSW 5 144856950 missense probably damaging 1.00
R6776:Trrap UTSW 5 144851256 nonsense probably null
R6914:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6942:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6945:Trrap UTSW 5 144790855 missense possibly damaging 0.66
R7023:Trrap UTSW 5 144792154 missense possibly damaging 0.64
R7107:Trrap UTSW 5 144797135 missense probably benign 0.05
R7139:Trrap UTSW 5 144803178 missense possibly damaging 0.65
R7148:Trrap UTSW 5 144821803 missense possibly damaging 0.77
X0060:Trrap UTSW 5 144843361 missense probably damaging 0.96
Z1088:Trrap UTSW 5 144834197 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGGTCCTATCAAGTACAGGG -3'
(R):5'- CGGAACACACTGCATACTTCTG -3'

Sequencing Primer
(F):5'- TGGTCCTATCAAGTACAGGGAAATC -3'
(R):5'- CACTGCATACTTCTGAAATGCTAGC -3'
Posted On2017-12-01