Incidental Mutation 'R5946:Pkp4'
ID501714
Institutional Source Beutler Lab
Gene Symbol Pkp4
Ensembl Gene ENSMUSG00000026991
Gene Nameplakophilin 4
SynonymsArmrp, 9430019K17Rik, 5031422I09Rik, p0071
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5946 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location59160850-59355208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59305067 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 94 (D94E)
Ref Sequence ENSEMBL: ENSMUSP00000139141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037903] [ENSMUST00000102754] [ENSMUST00000112577] [ENSMUST00000123908] [ENSMUST00000168631] [ENSMUST00000183359] [ENSMUST00000184332] [ENSMUST00000184705]
Predicted Effect probably benign
Transcript: ENSMUST00000037903
AA Change: D94E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042249
Gene: ENSMUSG00000026991
AA Change: D94E

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 574 614 5.68e-9 SMART
ARM 618 659 1.61e-8 SMART
ARM 660 717 4.54e1 SMART
ARM 719 766 9.97e0 SMART
low complexity region 777 788 N/A INTRINSIC
ARM 876 916 3.34e-6 SMART
ARM 964 1008 1.32e-4 SMART
low complexity region 1057 1073 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102754
AA Change: D94E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099815
Gene: ENSMUSG00000026991
AA Change: D94E

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 558 598 5.68e-9 SMART
ARM 602 643 1.61e-8 SMART
ARM 644 701 4.54e1 SMART
ARM 703 750 9.97e0 SMART
low complexity region 761 772 N/A INTRINSIC
ARM 860 900 3.34e-6 SMART
ARM 948 992 1.32e-4 SMART
low complexity region 1083 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112577
SMART Domains Protein: ENSMUSP00000108196
Gene: ENSMUSG00000026991

DomainStartEndE-ValueType
low complexity region 126 137 N/A INTRINSIC
ARM 217 257 5.68e-9 SMART
ARM 261 302 1.61e-8 SMART
ARM 303 360 4.54e1 SMART
ARM 362 409 9.97e0 SMART
low complexity region 420 431 N/A INTRINSIC
ARM 519 559 3.34e-6 SMART
ARM 607 651 1.32e-4 SMART
low complexity region 742 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123908
AA Change: D94E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122152
Gene: ENSMUSG00000026991
AA Change: D94E

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 574 614 5.68e-9 SMART
ARM 618 659 1.61e-8 SMART
ARM 660 717 4.54e1 SMART
ARM 719 766 9.97e0 SMART
low complexity region 777 788 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124725
Predicted Effect probably benign
Transcript: ENSMUST00000168631
AA Change: D94E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129836
Gene: ENSMUSG00000026991
AA Change: D94E

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 558 598 5.68e-9 SMART
ARM 602 643 1.61e-8 SMART
ARM 644 701 4.54e1 SMART
ARM 703 750 9.97e0 SMART
low complexity region 761 772 N/A INTRINSIC
ARM 860 900 3.34e-6 SMART
ARM 948 992 1.32e-4 SMART
low complexity region 1041 1057 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183359
AA Change: D94E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000139141
Gene: ENSMUSG00000026991
AA Change: D94E

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183625
Predicted Effect probably benign
Transcript: ENSMUST00000184332
Predicted Effect probably benign
Transcript: ENSMUST00000184705
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo-like proteins are characterized by a series of armadillo repeats, first defined in the Drosophila 'armadillo' gene product, that are typically 42 to 45 amino acids in length. These proteins can be divided into subfamilies based on their number of repeats, their overall sequence similarity, and the dispersion of the repeats throughout their sequences. Members of the p120(ctn)/plakophilin subfamily of Armadillo-like proteins, including CTNND1, CTNND2, PKP1, PKP2, PKP4, and ARVCF. PKP4 may be a component of desmosomal plaque and other adhesion plaques and is thought to be involved in regulating junctional plaque organization and cadherin function. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
PHENOTYPE: An uncharacterized gene trap insertion does not result in an obvious phenotype during the observation period early in life, although abnormalities may still develop at older age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,625,952 F1137S probably damaging Het
Actr6 G T 10: 89,728,192 Q73K probably benign Het
Adamtsl3 G A 7: 82,576,057 G358D probably damaging Het
Aggf1 A G 13: 95,371,576 V94A probably damaging Het
Arpc3 A G 5: 122,403,396 Y57C probably damaging Het
Asb2 A G 12: 103,321,555 Y630H probably benign Het
Atp1a1 A T 3: 101,589,774 N405K probably benign Het
C6 G T 15: 4,808,514 D869Y possibly damaging Het
Cds2 A G 2: 132,297,248 Y137C probably damaging Het
Ceacam12 A T 7: 18,069,206 E179V probably damaging Het
Chgb T A 2: 132,792,596 Y153N probably benign Het
Cit T A 5: 115,997,534 L1831Q probably damaging Het
Cpne8 C A 15: 90,488,988 *578L probably null Het
Cspg5 A G 9: 110,251,083 T440A probably damaging Het
Dnah7a A C 1: 53,559,308 V1393G probably damaging Het
Dnajb8 A G 6: 88,222,593 D37G probably benign Het
Dst A G 1: 34,174,192 I1063M probably benign Het
Efs T G 14: 54,919,494 probably null Het
Gpatch1 A G 7: 35,291,832 S596P probably damaging Het
Hbs1l C A 10: 21,341,756 H190Q probably benign Het
Ighm A G 12: 113,422,709 V7A unknown Het
Ivd A T 2: 118,876,889 I295F possibly damaging Het
Kcnq5 A C 1: 21,505,707 S258A probably damaging Het
Mad1l1 G T 5: 140,261,579 P331Q probably damaging Het
Mcf2l G T 8: 13,013,922 G1045C probably damaging Het
Mcoln1 T A 8: 3,508,701 I233N probably damaging Het
Mmp13 T C 9: 7,276,580 L225P probably damaging Het
Muc5ac G A 7: 141,817,907 C2615Y possibly damaging Het
Myh7b T C 2: 155,621,395 F516L probably damaging Het
Obsl1 A T 1: 75,491,207 S1347R probably damaging Het
Ogn A G 13: 49,618,285 N207S probably benign Het
Olfr132 C A 17: 38,130,707 A162S probably benign Het
Olfr874 T A 9: 37,747,034 L300Q probably damaging Het
Pcdha2 G T 18: 36,941,106 V597L probably damaging Het
Pcnt T A 10: 76,382,063 Y2126F possibly damaging Het
Pgbd5 A T 8: 124,374,317 M400K possibly damaging Het
Pklr A T 3: 89,136,196 E5V probably benign Het
Ppan C T 9: 20,889,673 Q111* probably null Het
Prkcb A G 7: 122,544,703 N330S probably benign Het
Prl4a1 T A 13: 28,018,516 W25R probably damaging Het
Rars2 T A 4: 34,656,855 H501Q possibly damaging Het
Ryr2 T C 13: 11,726,953 D2114G probably damaging Het
Serinc2 G T 4: 130,255,521 T351K possibly damaging Het
Slc22a12 A G 19: 6,537,851 F358L probably damaging Het
Sorcs2 A C 5: 36,029,083 V905G probably damaging Het
Tekt3 G C 11: 63,094,747 A460P probably damaging Het
Tm4sf1 T G 3: 57,292,868 I109L possibly damaging Het
Tmc5 A T 7: 118,670,725 E899D probably damaging Het
Tmem268 C T 4: 63,568,509 P90S probably damaging Het
Trim38 A G 13: 23,782,734 M55V probably benign Het
Trip10 T G 17: 57,250,963 V50G probably damaging Het
Usp25 T A 16: 77,115,054 C990* probably null Het
Uts2 A G 4: 150,999,049 D39G probably benign Het
Vezf1 T A 11: 88,073,734 C49* probably null Het
Wee2 T A 6: 40,463,212 N431K probably null Het
Yeats2 C A 16: 20,207,763 Y796* probably null Het
Zfp592 G A 7: 81,037,897 G890D possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Pkp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pkp4 APN 2 59338755 missense probably damaging 0.99
IGL00987:Pkp4 APN 2 59308357 missense probably damaging 0.98
IGL01321:Pkp4 APN 2 59350627 splice site probably null
IGL01393:Pkp4 APN 2 59347925 missense probably damaging 1.00
IGL02058:Pkp4 APN 2 59311729 nonsense probably null
IGL02313:Pkp4 APN 2 59310254 nonsense probably null
IGL02635:Pkp4 APN 2 59305498 unclassified probably benign
IGL03017:Pkp4 APN 2 59266425 missense probably benign 0.06
IGL03051:Pkp4 APN 2 59311762 missense probably benign 0.29
degrasso UTSW 2 59318600 missense probably damaging 1.00
melted UTSW 2 59334932 critical splice donor site probably null
R0206:Pkp4 UTSW 2 59266436 missense probably damaging 0.99
R0207:Pkp4 UTSW 2 59305488 missense possibly damaging 0.89
R0208:Pkp4 UTSW 2 59266436 missense probably damaging 0.99
R0325:Pkp4 UTSW 2 59318529 missense probably damaging 1.00
R0620:Pkp4 UTSW 2 59322643 missense possibly damaging 0.46
R0781:Pkp4 UTSW 2 59338765 missense probably damaging 1.00
R1110:Pkp4 UTSW 2 59338765 missense probably damaging 1.00
R1537:Pkp4 UTSW 2 59214803 missense probably damaging 1.00
R1607:Pkp4 UTSW 2 59322554 missense probably benign 0.00
R1654:Pkp4 UTSW 2 59337619 missense probably damaging 0.96
R1760:Pkp4 UTSW 2 59311841 missense probably damaging 0.97
R2051:Pkp4 UTSW 2 59334904 missense probably benign 0.37
R2871:Pkp4 UTSW 2 59308156 missense probably benign 0.35
R2871:Pkp4 UTSW 2 59308156 missense probably benign 0.35
R3161:Pkp4 UTSW 2 59308105 missense probably damaging 1.00
R4261:Pkp4 UTSW 2 59305162 missense probably damaging 1.00
R4342:Pkp4 UTSW 2 59350608 missense probably damaging 0.98
R4731:Pkp4 UTSW 2 59334932 critical splice donor site probably null
R4799:Pkp4 UTSW 2 59342105 missense probably damaging 1.00
R4913:Pkp4 UTSW 2 59305450 missense probably damaging 1.00
R5383:Pkp4 UTSW 2 59310273 nonsense probably null
R5418:Pkp4 UTSW 2 59310162 missense probably benign 0.09
R5906:Pkp4 UTSW 2 59305076 missense possibly damaging 0.79
R6360:Pkp4 UTSW 2 59214747 missense probably benign 0.01
R6616:Pkp4 UTSW 2 59350552 nonsense probably null
R6817:Pkp4 UTSW 2 59318600 missense probably damaging 1.00
R7390:Pkp4 UTSW 2 59310140 missense possibly damaging 0.94
R7408:Pkp4 UTSW 2 59311766 missense probably damaging 1.00
R7464:Pkp4 UTSW 2 59308137 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ATGTGGACTTGGAACCAGAAC -3'
(R):5'- TGAGGCTCATCTTCAAAGGG -3'

Sequencing Primer
(F):5'- TGGACTTGGAACCAGAACAAACAATG -3'
(R):5'- GGCTCATCTTCAAAGGGAAAATATG -3'
Posted On2017-12-01