Incidental Mutation 'R5920:Phykpl'
ID501716
Institutional Source Beutler Lab
Gene Symbol Phykpl
Ensembl Gene ENSMUSG00000020359
Gene Name5-phosphohydroxy-L-lysine phospholyase
SynonymsAgxt2l2, 2900006B13Rik
MMRRC Submission 044117-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.519) question?
Stock #R5920 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location51584757-51604489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 51602795 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 453 (E453A)
Ref Sequence ENSEMBL: ENSMUSP00000132190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020625] [ENSMUST00000074669] [ENSMUST00000101249] [ENSMUST00000101250] [ENSMUST00000109103] [ENSMUST00000167797]
Predicted Effect probably benign
Transcript: ENSMUST00000020625
SMART Domains Protein: ENSMUSP00000020625
Gene: ENSMUSG00000020359

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Aminotran_3 27 433 2.1e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074669
SMART Domains Protein: ENSMUSP00000074238
Gene: ENSMUSG00000020358

DomainStartEndE-ValueType
low complexity region 21 55 N/A INTRINSIC
RRM 76 148 3.59e-25 SMART
RRM 160 232 5.79e-20 SMART
low complexity region 240 270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101249
SMART Domains Protein: ENSMUSP00000098807
Gene: ENSMUSG00000020358

DomainStartEndE-ValueType
low complexity region 21 55 N/A INTRINSIC
RRM 76 148 3.59e-25 SMART
RRM 160 232 5.79e-20 SMART
low complexity region 240 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101250
SMART Domains Protein: ENSMUSP00000098808
Gene: ENSMUSG00000020359

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Aminotran_3 33 212 8.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109103
SMART Domains Protein: ENSMUSP00000104731
Gene: ENSMUSG00000020358

DomainStartEndE-ValueType
Pfam:CBFNT 1 75 5.7e-23 PFAM
RRM 76 148 3.59e-25 SMART
RRM 160 232 5.79e-20 SMART
low complexity region 240 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167797
AA Change: E453A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132190
Gene: ENSMUSG00000020359
AA Change: E453A

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Aminotran_3 33 373 1.5e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169995
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene overlaps in a tail-to-tail orientation the gene encoding heterogeneous nuclear ribonucleoprotein A/B. The terminal exon of this gene is interspersed with exons of heterogeneous nuclear ribonucleoprotein A/B. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,637,981 K40M probably damaging Het
Adam18 T C 8: 24,674,075 K31E probably damaging Het
Ak9 T A 10: 41,420,676 C1473S probably benign Het
Aox1 T C 1: 58,049,472 L139S probably damaging Het
Arhgap45 T A 10: 80,029,131 V849D possibly damaging Het
Atp13a1 G A 8: 69,800,096 E689K probably benign Het
Calcr G A 6: 3,722,994 R11W probably damaging Het
Casd1 T A 6: 4,641,853 L710Q probably null Het
Cenpc1 T A 5: 86,020,910 T743S probably benign Het
Cfap43 A G 19: 47,760,896 V1185A possibly damaging Het
Chd2 A G 7: 73,537,312 L33P probably damaging Het
Col24a1 G T 3: 145,428,230 G889C probably damaging Het
Dbh T C 2: 27,177,231 probably benign Het
Dcdc2c T C 12: 28,535,537 I154V possibly damaging Het
Eif2b5 G T 16: 20,498,944 A11S unknown Het
Fam105a T A 15: 27,664,356 R109S possibly damaging Het
Frmd4a T G 2: 4,333,116 N44K probably benign Het
Fsip2 C T 2: 82,988,508 Q4862* probably null Het
Hectd4 C T 5: 121,308,271 T1513I possibly damaging Het
Hspg2 A T 4: 137,553,782 D3355V probably damaging Het
Il16 G A 7: 83,652,344 T190I probably benign Het
Immt T A 6: 71,863,196 V319D probably benign Het
Kdm2b G C 5: 122,880,296 S989W probably damaging Het
Kmt2e A G 5: 23,499,442 E1211G possibly damaging Het
Ktn1 G T 14: 47,724,024 G1061* probably null Het
Mast3 T C 8: 70,787,933 I287V probably benign Het
Mrgpre T A 7: 143,781,728 T13S probably benign Het
Myoc C T 1: 162,639,559 A99V probably benign Het
Olfr517 C A 7: 108,868,688 M155I probably benign Het
Per3 G A 4: 151,012,450 P873S probably benign Het
Pkd2l2 A T 18: 34,430,773 I514L probably benign Het
Plcl2 G T 17: 50,608,675 R904L probably damaging Het
Ptpn1 A G 2: 167,971,748 D137G probably benign Het
Rasal3 G A 17: 32,395,169 P571S probably damaging Het
Sdha A G 13: 74,326,925 probably null Het
Tbc1d31 C A 15: 57,942,558 Q439K probably benign Het
Ttc12 T C 9: 49,453,333 D381G possibly damaging Het
Ttc26 A G 6: 38,412,070 Y430C probably damaging Het
Uaca T A 9: 60,869,603 M424K probably benign Het
Usp33 G T 3: 152,374,683 A484S probably damaging Het
Usp9y A G Y: 1,316,730 S1940P probably damaging Het
Zfp532 G A 18: 65,644,350 V893I probably benign Het
Other mutations in Phykpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Phykpl APN 11 51599456 splice site probably benign
IGL01809:Phykpl APN 11 51599524 missense probably benign 0.09
IGL02636:Phykpl APN 11 51598713 missense probably damaging 1.00
IGL02668:Phykpl APN 11 51593687 critical splice donor site probably null
R0114:Phykpl UTSW 11 51586653 missense probably benign 0.00
R0308:Phykpl UTSW 11 51593596 splice site probably benign
R0332:Phykpl UTSW 11 51586675 missense probably benign 0.30
R0831:Phykpl UTSW 11 51585539 nonsense probably null
R3434:Phykpl UTSW 11 51598655 missense probably benign
R4272:Phykpl UTSW 11 51585528 missense probably damaging 1.00
R4539:Phykpl UTSW 11 51594088 missense probably damaging 1.00
R4618:Phykpl UTSW 11 51592229 missense probably damaging 1.00
R4633:Phykpl UTSW 11 51593608 missense probably damaging 1.00
R4816:Phykpl UTSW 11 51592953 missense probably benign
R4823:Phykpl UTSW 11 51586593 missense probably damaging 0.99
R5415:Phykpl UTSW 11 51585515 missense probably benign 0.00
R6370:Phykpl UTSW 11 51586716 missense probably damaging 1.00
R6611:Phykpl UTSW 11 51598354 missense probably damaging 1.00
R6617:Phykpl UTSW 11 51593954 missense probably damaging 1.00
R7319:Phykpl UTSW 11 51598703 missense probably benign 0.20
R7340:Phykpl UTSW 11 51599543 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAAGTCTTCATCCAGCTCC -3'
(R):5'- ACCATCCTCAAAGTTTTCAGGC -3'

Sequencing Primer
(F):5'- CGGTTCCCTCGATTGCG -3'
(R):5'- TCAGGCATAAAAGTCTGACTGGGTC -3'
Posted On2017-12-01