Incidental Mutation 'R5921:Golga2'
ID501717
Institutional Source Beutler Lab
Gene Symbol Golga2
Ensembl Gene ENSMUSG00000002546
Gene Namegolgi autoantigen, golgin subfamily a, 2
SynonymsGM130
MMRRC Submission 044118-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.851) question?
Stock #R5921 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32287384-32307921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32297755 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 194 (N194S)
Ref Sequence ENSEMBL: ENSMUSP00000117476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081670] [ENSMUST00000100194] [ENSMUST00000113377] [ENSMUST00000129193] [ENSMUST00000139494]
Predicted Effect probably benign
Transcript: ENSMUST00000081670
AA Change: N114S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080374
Gene: ENSMUSG00000002546
AA Change: N114S

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
coiled coil region 105 173 N/A INTRINSIC
low complexity region 189 202 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
Pfam:GOLGA2L5 337 955 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100194
AA Change: N184S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097768
Gene: ENSMUSG00000002546
AA Change: N184S

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
coiled coil region 176 244 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 372 384 N/A INTRINSIC
Pfam:GOLGA2L5 408 1026 2.1e-299 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113377
AA Change: N157S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109004
Gene: ENSMUSG00000002546
AA Change: N157S

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
coiled coil region 149 217 N/A INTRINSIC
low complexity region 233 246 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:GOLGA2L5 381 999 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127276
Predicted Effect probably benign
Transcript: ENSMUST00000129193
SMART Domains Protein: ENSMUSP00000115003
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 31 37 N/A INTRINSIC
low complexity region 57 72 N/A INTRINSIC
coiled coil region 136 176 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
coiled coil region 226 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131712
SMART Domains Protein: ENSMUSP00000114169
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
coiled coil region 106 146 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
coiled coil region 196 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139494
AA Change: N194S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117476
Gene: ENSMUSG00000002546
AA Change: N194S

DomainStartEndE-ValueType
low complexity region 55 61 N/A INTRINSIC
low complexity region 108 123 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146544
Predicted Effect probably benign
Transcript: ENSMUST00000147707
SMART Domains Protein: ENSMUSP00000121886
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
coiled coil region 165 205 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149141
Meta Mutation Damage Score 0.1264 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 95% (70/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein has been postulated to play roles in the stacking of Golgi cisternae and in vesicular transport. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of these variants has not been determined. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik G T 8: 13,734,840 A34S probably damaging Het
Ablim2 G A 5: 35,812,211 V223M probably damaging Het
Adamts7 T C 9: 90,188,694 S623P probably benign Het
Aqp7 G T 4: 41,036,093 N48K probably benign Het
Asic4 A G 1: 75,451,373 N181S probably benign Het
Blvra A T 2: 127,087,363 probably benign Het
Bmf C A 2: 118,532,553 probably benign Het
Bnc2 A T 4: 84,293,055 I454N possibly damaging Het
Catsperg1 A T 7: 29,190,523 L700H possibly damaging Het
Ccdc14 T C 16: 34,706,391 V222A probably damaging Het
Clstn3 A T 6: 124,431,580 probably benign Het
Col15a1 A T 4: 47,300,602 I1066F probably damaging Het
Dcdc2c T C 12: 28,524,775 E116G possibly damaging Het
Dopey1 G A 9: 86,501,922 S310N probably damaging Het
Dync1h1 T A 12: 110,618,368 V735E probably damaging Het
Eva1a T C 6: 82,092,159 Y156H probably damaging Het
Fbxw26 A G 9: 109,746,018 I13T probably damaging Het
Fermt2 A T 14: 45,464,746 L527Q probably damaging Het
Fxyd4 G A 6: 117,936,138 probably benign Het
Gal A G 19: 3,410,100 S124P probably damaging Het
Glmp T C 3: 88,325,976 S56P probably benign Het
Gm5600 T C 7: 113,708,176 noncoding transcript Het
Gon4l T C 3: 88,909,947 probably benign Het
Gtf2ird2 T A 5: 134,217,584 Y895N probably damaging Het
Hsd3b1 C A 3: 98,857,899 M22I probably benign Het
Ipo13 A C 4: 117,912,089 L169V probably benign Het
Kif13a G T 13: 46,825,300 T208K probably damaging Het
Klhl5 G T 5: 65,162,956 A618S probably damaging Het
Lrig2 A T 3: 104,462,754 L496* probably null Het
Macf1 A G 4: 123,526,711 I250T probably benign Het
Man1a A G 10: 53,907,510 I632T probably damaging Het
Nav2 A G 7: 49,304,576 probably benign Het
Nek8 A G 11: 78,173,059 M40T probably damaging Het
Oas3 T C 5: 120,769,981 D298G probably damaging Het
Ociad1 A G 5: 73,310,382 D167G probably benign Het
Olfr115 A T 17: 37,610,219 C177* probably null Het
Olfr12 T A 1: 92,620,622 S239T probably benign Het
Olfr284 T C 15: 98,340,429 T187A probably benign Het
Pafah2 G T 4: 134,418,069 V255L probably benign Het
Pde10a A G 17: 8,930,537 Y407C probably damaging Het
Pirb A C 7: 3,716,694 Y484* probably null Het
Prl8a6 A G 13: 27,437,188 S20P probably damaging Het
R3hdm4 A T 10: 79,913,619 V52E probably damaging Het
Rab3ip A G 10: 116,939,247 Y69H probably damaging Het
Rxrg T C 1: 167,639,239 M330T possibly damaging Het
Sema4g G T 19: 44,998,704 G460V probably benign Het
Sidt1 T C 16: 44,273,735 probably benign Het
Slc12a2 T A 18: 57,932,523 D943E probably benign Het
Slc12a4 T C 8: 105,945,244 probably null Het
Slc4a3 T G 1: 75,557,444 probably null Het
Slc4a8 C T 15: 100,814,447 probably benign Het
Srcap T A 7: 127,558,833 probably benign Het
Stk39 A G 2: 68,366,105 S327P probably damaging Het
Tbc1d5 G A 17: 50,963,693 T170M probably damaging Het
Trim13 T A 14: 61,605,089 F185Y probably benign Het
Ttc17 A G 2: 94,378,848 V87A probably damaging Het
Ttn A T 2: 76,720,863 M31395K possibly damaging Het
Usp34 T A 11: 23,464,686 D2876E probably damaging Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn2r93 T A 17: 18,325,768 L634Q probably damaging Het
Vmp1 C T 11: 86,586,510 A355T probably benign Het
Xpo5 A T 17: 46,221,421 M461L probably benign Het
Zfp759 T A 13: 67,140,494 F703Y probably damaging Het
Other mutations in Golga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Golga2 APN 2 32305214 missense probably benign 0.01
IGL01561:Golga2 APN 2 32296677 missense probably benign 0.00
IGL02396:Golga2 APN 2 32298644 splice site probably benign
IGL02636:Golga2 APN 2 32296723 critical splice donor site probably null
IGL02712:Golga2 APN 2 32304213 missense probably damaging 1.00
IGL03172:Golga2 APN 2 32292156 missense probably benign 0.04
IGL03193:Golga2 APN 2 32305008 missense probably damaging 1.00
R0050:Golga2 UTSW 2 32292127 missense probably damaging 0.96
R0050:Golga2 UTSW 2 32292127 missense probably damaging 0.96
R0265:Golga2 UTSW 2 32304952 splice site probably null
R0440:Golga2 UTSW 2 32302933 missense probably damaging 1.00
R0644:Golga2 UTSW 2 32297521 missense probably damaging 1.00
R0825:Golga2 UTSW 2 32304791 missense probably damaging 1.00
R1179:Golga2 UTSW 2 32303695 missense possibly damaging 0.50
R1447:Golga2 UTSW 2 32297776 missense possibly damaging 0.69
R1459:Golga2 UTSW 2 32297795 unclassified probably null
R1517:Golga2 UTSW 2 32305984 nonsense probably null
R1522:Golga2 UTSW 2 32302204 missense probably benign 0.01
R1599:Golga2 UTSW 2 32303173 missense probably benign 0.00
R1702:Golga2 UTSW 2 32299275 missense probably damaging 1.00
R1716:Golga2 UTSW 2 32302897 missense probably damaging 1.00
R1777:Golga2 UTSW 2 32305470 splice site probably null
R1781:Golga2 UTSW 2 32306576 missense probably damaging 1.00
R2229:Golga2 UTSW 2 32306465 missense probably benign 0.06
R2484:Golga2 UTSW 2 32304770 missense probably benign 0.32
R2972:Golga2 UTSW 2 32305659 missense probably benign 0.16
R3411:Golga2 UTSW 2 32302942 missense probably damaging 0.98
R3851:Golga2 UTSW 2 32305611 missense probably benign 0.30
R3852:Golga2 UTSW 2 32305611 missense probably benign 0.30
R4130:Golga2 UTSW 2 32288166 missense probably benign 0.07
R4783:Golga2 UTSW 2 32297156 missense probably damaging 1.00
R4784:Golga2 UTSW 2 32297156 missense probably damaging 1.00
R4785:Golga2 UTSW 2 32297156 missense probably damaging 1.00
R4808:Golga2 UTSW 2 32303214 missense probably benign 0.00
R5103:Golga2 UTSW 2 32303746 missense probably benign 0.09
R5261:Golga2 UTSW 2 32304154 missense probably benign 0.02
R5315:Golga2 UTSW 2 32303761 missense probably damaging 1.00
R5508:Golga2 UTSW 2 32288187 nonsense probably null
R5627:Golga2 UTSW 2 32306047 nonsense probably null
R6678:Golga2 UTSW 2 32299060 missense probably damaging 0.99
R7365:Golga2 UTSW 2 32303001 nonsense probably null
R7390:Golga2 UTSW 2 32288190 missense
R7395:Golga2 UTSW 2 32305587 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTCCAACATGAAGGAACTGGAG -3'
(R):5'- AGACTCAAGCCCCAGGTTTTC -3'

Sequencing Primer
(F):5'- AGGTGAGTGGCCTGGACTC -3'
(R):5'- ATTCCCCTTGGTCCCAGGG -3'
Posted On2017-12-01