Incidental Mutation 'R5921:Tbc1d5'
ID501720
Institutional Source Beutler Lab
Gene Symbol Tbc1d5
Ensembl Gene ENSMUSG00000023923
Gene NameTBC1 domain family, member 5
Synonyms1600014N05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R5921 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location50733124-51179352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50963693 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 170 (T170M)
Ref Sequence ENSEMBL: ENSMUSP00000153172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024717] [ENSMUST00000224528]
Predicted Effect probably damaging
Transcript: ENSMUST00000024717
AA Change: T170M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024717
Gene: ENSMUSG00000023923
AA Change: T170M

DomainStartEndE-ValueType
TBC 78 384 5.56e-86 SMART
low complexity region 475 492 N/A INTRINSIC
SCOP:d1lsha3 511 546 1e-3 SMART
low complexity region 556 568 N/A INTRINSIC
low complexity region 783 802 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224123
Predicted Effect probably damaging
Transcript: ENSMUST00000224528
AA Change: T170M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225252
Meta Mutation Damage Score 0.388 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 95% (70/74)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik G T 8: 13,734,840 A34S probably damaging Het
Ablim2 G A 5: 35,812,211 V223M probably damaging Het
Adamts7 T C 9: 90,188,694 S623P probably benign Het
Aqp7 G T 4: 41,036,093 N48K probably benign Het
Asic4 A G 1: 75,451,373 N181S probably benign Het
Blvra A T 2: 127,087,363 probably benign Het
Bmf C A 2: 118,532,553 probably benign Het
Bnc2 A T 4: 84,293,055 I454N possibly damaging Het
Catsperg1 A T 7: 29,190,523 L700H possibly damaging Het
Ccdc14 T C 16: 34,706,391 V222A probably damaging Het
Clstn3 A T 6: 124,431,580 probably benign Het
Col15a1 A T 4: 47,300,602 I1066F probably damaging Het
Dcdc2c T C 12: 28,524,775 E116G possibly damaging Het
Dopey1 G A 9: 86,501,922 S310N probably damaging Het
Dync1h1 T A 12: 110,618,368 V735E probably damaging Het
Eva1a T C 6: 82,092,159 Y156H probably damaging Het
Fbxw26 A G 9: 109,746,018 I13T probably damaging Het
Fermt2 A T 14: 45,464,746 L527Q probably damaging Het
Fxyd4 G A 6: 117,936,138 probably benign Het
Gal A G 19: 3,410,100 S124P probably damaging Het
Glmp T C 3: 88,325,976 S56P probably benign Het
Gm5600 T C 7: 113,708,176 noncoding transcript Het
Golga2 A G 2: 32,297,755 N194S probably benign Het
Gon4l T C 3: 88,909,947 probably benign Het
Gtf2ird2 T A 5: 134,217,584 Y895N probably damaging Het
Hsd3b1 C A 3: 98,857,899 M22I probably benign Het
Ipo13 A C 4: 117,912,089 L169V probably benign Het
Kif13a G T 13: 46,825,300 T208K probably damaging Het
Klhl5 G T 5: 65,162,956 A618S probably damaging Het
Lrig2 A T 3: 104,462,754 L496* probably null Het
Macf1 A G 4: 123,526,711 I250T probably benign Het
Man1a A G 10: 53,907,510 I632T probably damaging Het
Nav2 A G 7: 49,304,576 probably benign Het
Nek8 A G 11: 78,173,059 M40T probably damaging Het
Oas3 T C 5: 120,769,981 D298G probably damaging Het
Ociad1 A G 5: 73,310,382 D167G probably benign Het
Olfr115 A T 17: 37,610,219 C177* probably null Het
Olfr12 T A 1: 92,620,622 S239T probably benign Het
Olfr284 T C 15: 98,340,429 T187A probably benign Het
Pafah2 G T 4: 134,418,069 V255L probably benign Het
Pde10a A G 17: 8,930,537 Y407C probably damaging Het
Pirb A C 7: 3,716,694 Y484* probably null Het
Prl8a6 A G 13: 27,437,188 S20P probably damaging Het
R3hdm4 A T 10: 79,913,619 V52E probably damaging Het
Rab3ip A G 10: 116,939,247 Y69H probably damaging Het
Rxrg T C 1: 167,639,239 M330T possibly damaging Het
Sema4g G T 19: 44,998,704 G460V probably benign Het
Sidt1 T C 16: 44,273,735 probably benign Het
Slc12a2 T A 18: 57,932,523 D943E probably benign Het
Slc12a4 T C 8: 105,945,244 probably null Het
Slc4a3 T G 1: 75,557,444 probably null Het
Slc4a8 C T 15: 100,814,447 probably benign Het
Srcap T A 7: 127,558,833 probably benign Het
Stk39 A G 2: 68,366,105 S327P probably damaging Het
Trim13 T A 14: 61,605,089 F185Y probably benign Het
Ttc17 A G 2: 94,378,848 V87A probably damaging Het
Ttn A T 2: 76,720,863 M31395K possibly damaging Het
Usp34 T A 11: 23,464,686 D2876E probably damaging Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn2r93 T A 17: 18,325,768 L634Q probably damaging Het
Vmp1 C T 11: 86,586,510 A355T probably benign Het
Xpo5 A T 17: 46,221,421 M461L probably benign Het
Zfp759 T A 13: 67,140,494 F703Y probably damaging Het
Other mutations in Tbc1d5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Tbc1d5 APN 17 50813798 missense possibly damaging 0.52
IGL01370:Tbc1d5 APN 17 50966727 missense probably benign 0.18
IGL01625:Tbc1d5 APN 17 50917573 missense probably benign 0.27
IGL01935:Tbc1d5 APN 17 50963765 splice site probably benign
IGL02229:Tbc1d5 APN 17 50852600 missense probably damaging 1.00
IGL02811:Tbc1d5 APN 17 50800121 missense probably damaging 0.99
IGL03192:Tbc1d5 APN 17 50984681 splice site probably benign
FR4976:Tbc1d5 UTSW 17 50799931 missense probably benign
FR4976:Tbc1d5 UTSW 17 50799943 missense probably benign 0.01
IGL02796:Tbc1d5 UTSW 17 50966624 missense probably damaging 1.00
R0153:Tbc1d5 UTSW 17 50984687 splice site probably benign
R0326:Tbc1d5 UTSW 17 50966736 missense probably damaging 1.00
R0417:Tbc1d5 UTSW 17 50756705 missense probably benign 0.18
R0481:Tbc1d5 UTSW 17 50919051 missense probably damaging 0.98
R1143:Tbc1d5 UTSW 17 50742059 nonsense probably null
R1533:Tbc1d5 UTSW 17 50920575 missense possibly damaging 0.89
R1543:Tbc1d5 UTSW 17 50935532 missense probably benign 0.32
R2888:Tbc1d5 UTSW 17 50935549 missense probably damaging 1.00
R3153:Tbc1d5 UTSW 17 50968236 missense probably damaging 1.00
R3430:Tbc1d5 UTSW 17 50800128 missense probably damaging 1.00
R3898:Tbc1d5 UTSW 17 50963744 missense probably damaging 0.98
R4116:Tbc1d5 UTSW 17 50920587 missense probably damaging 1.00
R4352:Tbc1d5 UTSW 17 50782401 missense probably damaging 0.98
R4456:Tbc1d5 UTSW 17 50782341 missense probably damaging 1.00
R4648:Tbc1d5 UTSW 17 50736223 missense probably benign
R4711:Tbc1d5 UTSW 17 50935509 missense probably damaging 0.98
R4754:Tbc1d5 UTSW 17 50800165 missense probably benign 0.03
R5303:Tbc1d5 UTSW 17 50736200 missense probably benign 0.00
R5360:Tbc1d5 UTSW 17 50984632 missense probably benign 0.26
R5443:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5444:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5611:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5658:Tbc1d5 UTSW 17 50813841 missense probably benign 0.18
R5701:Tbc1d5 UTSW 17 50799955 small deletion probably benign
R6280:Tbc1d5 UTSW 17 50782310 missense probably benign 0.01
R6628:Tbc1d5 UTSW 17 50736208 missense probably benign
R6705:Tbc1d5 UTSW 17 51025175 start gained probably benign
R6990:Tbc1d5 UTSW 17 50968232 missense probably benign 0.19
Z1088:Tbc1d5 UTSW 17 50963696 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTGAATACAATTGGCCATTC -3'
(R):5'- TGCACTCAGTAAGGGACTAAAAC -3'

Sequencing Primer
(F):5'- GAATACAATTGGCCATTCTATGACAG -3'
(R):5'- TCAGTAAGGGACTAAAACATGGATAC -3'
Posted On2017-12-01