Incidental Mutation 'R5931:Dbt'
ID501725
Institutional Source Beutler Lab
Gene Symbol Dbt
Ensembl Gene ENSMUSG00000000340
Gene Namedihydrolipoamide branched chain transacylase E2
SynonymsD3Wsu60e, dihydrolipoyllysine-residue (2-methylpropanoyl)transferase, dihydrolipoyl transacylase, BCKAD E2
MMRRC Submission 044126-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5931 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location116513070-116549981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116523425 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 83 (E83D)
Ref Sequence ENSEMBL: ENSMUSP00000000349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000349] [ENSMUST00000197201] [ENSMUST00000199614]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000349
AA Change: E83D

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000000349
Gene: ENSMUSG00000000340
AA Change: E83D

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 65 138 2.8e-22 PFAM
Pfam:E3_binding 171 206 4.4e-18 PFAM
low complexity region 218 232 N/A INTRINSIC
Pfam:2-oxoacid_dh 248 479 8.5e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196376
Predicted Effect probably benign
Transcript: ENSMUST00000197201
Predicted Effect probably benign
Transcript: ENSMUST00000199614
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-keto acid dehydrogenase complex (BCKD) is an inner-mitochondrial enzyme complex involved in the breakdown of the branched-chain amino acids isoleucine, leucine, and valine. The BCKD complex is thought to be composed of a core of 24 transacylase (E2) subunits, and associated decarboxylase (E1), dehydrogenase (E3), and regulatory subunits. This gene encodes the transacylase (E2) subunit. Mutations in this gene result in maple syrup urine disease, type 2. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in postnatal lethality, pallor, respiratory distress, and an increase in branched-chain amino acids in the blood and urine. Homozygotes model Maple Syrup Urine Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,189 T2M probably damaging Het
4930590J08Rik A T 6: 91,919,115 R315W probably damaging Het
Atrn A T 2: 130,933,436 Y153F possibly damaging Het
C4b A G 17: 34,729,193 V1644A probably damaging Het
Carmil3 A C 14: 55,498,940 K654T probably damaging Het
Cdh1 T C 8: 106,666,332 probably null Het
Chrna1 C T 2: 73,568,100 V332M probably benign Het
Clca2 A C 3: 145,092,125 V193G possibly damaging Het
Cyld A G 8: 88,729,842 probably null Het
Deup1 T C 9: 15,561,322 R471G possibly damaging Het
Dgcr2 T A 16: 17,857,309 I188F possibly damaging Het
Dgkg G A 16: 22,558,038 R524* probably null Het
Dnah5 A T 15: 28,453,279 R4399W probably damaging Het
Egflam G A 15: 7,243,857 T579I possibly damaging Het
Eif2b2 C T 12: 85,222,787 T211I probably damaging Het
Ep400 A G 5: 110,735,520 probably benign Het
Ermp1 C G 19: 29,615,729 A788P probably benign Het
Ern1 A G 11: 106,426,873 S142P possibly damaging Het
Fbxo15 T A 18: 84,981,125 C351S probably damaging Het
Fndc3a A T 14: 72,568,867 S444T probably benign Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gm6169 A G 13: 97,099,197 L14S probably benign Het
Gpbp1l1 T C 4: 116,590,260 V379A probably benign Het
Hook2 G T 8: 84,995,746 E305* probably null Het
Hoxa3 G A 6: 52,172,588 A21V probably damaging Het
Hs1bp3 C A 12: 8,341,915 P339Q probably benign Het
Igha T A 12: 113,260,090 T49S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Lats2 A G 14: 57,696,131 L843P probably damaging Het
Lcmt1 A G 7: 123,421,616 T255A probably benign Het
Lpar6 A G 14: 73,238,928 I110V probably damaging Het
Lrrtm4 A G 6: 80,021,739 I44V probably damaging Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Muc20 A T 16: 32,794,574 D144E possibly damaging Het
Nphp3 T A 9: 104,020,746 D417E probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Olfr889 A G 9: 38,116,374 I193V probably benign Het
Paqr7 A C 4: 134,507,720 Y296S probably damaging Het
Pcdha4 A T 18: 36,954,755 T664S probably damaging Het
Pelo T A 13: 115,088,843 Y282F probably benign Het
Plxna2 A T 1: 194,810,870 I1818F probably damaging Het
Pnkd A G 1: 74,350,674 D319G probably benign Het
Pnmal1 C A 7: 16,960,884 N221K probably benign Het
Ppp1cb T A 5: 32,483,466 probably null Het
Prkca T G 11: 108,014,310 I201L probably benign Het
Rfx2 G A 17: 56,780,778 R538C probably damaging Het
Rph3a T C 5: 120,963,873 Q100R probably damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Scel T A 14: 103,605,624 Y547* probably null Het
Sp100 C T 1: 85,679,083 P303L probably damaging Het
Stk31 A G 6: 49,469,302 S958G probably benign Het
Syne2 T A 12: 76,008,865 V4168E probably benign Het
Tenm3 A T 8: 48,646,498 S91T probably benign Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tmem248 T A 5: 130,229,508 I14N probably damaging Het
Tor3a T C 1: 156,656,487 I298V probably benign Het
Trim69 A T 2: 122,178,594 K378N probably damaging Het
Ttc28 C T 5: 111,085,109 P151S possibly damaging Het
Uaca T C 9: 60,872,012 V1225A probably damaging Het
Vps4b T C 1: 106,777,335 I343V probably benign Het
Wnk4 A G 11: 101,261,221 T184A probably damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Other mutations in Dbt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Dbt APN 3 116539281 missense probably benign
IGL00660:Dbt APN 3 116546295 missense probably damaging 1.00
IGL00839:Dbt APN 3 116546114 missense probably benign 0.21
IGL00840:Dbt APN 3 116546114 missense probably benign 0.21
IGL00841:Dbt APN 3 116546114 missense probably benign 0.21
IGL00852:Dbt APN 3 116546114 missense probably benign 0.21
IGL00861:Dbt APN 3 116546114 missense probably benign 0.21
IGL00955:Dbt APN 3 116546114 missense probably benign 0.21
IGL00956:Dbt APN 3 116546114 missense probably benign 0.21
IGL01475:Dbt APN 3 116520259 missense possibly damaging 0.92
IGL01521:Dbt APN 3 116533383 missense probably benign 0.00
IGL01806:Dbt APN 3 116533305 missense probably damaging 1.00
IGL03288:Dbt APN 3 116548198 makesense probably null
R0025:Dbt UTSW 3 116534783 missense probably benign 0.22
R0066:Dbt UTSW 3 116543829 missense probably benign 0.00
R0066:Dbt UTSW 3 116543829 missense probably benign 0.00
R0190:Dbt UTSW 3 116539087 critical splice acceptor site probably null
R1650:Dbt UTSW 3 116534732 splice site probably null
R1750:Dbt UTSW 3 116546294 missense probably benign 0.18
R2130:Dbt UTSW 3 116539124 missense probably damaging 1.00
R2131:Dbt UTSW 3 116539124 missense probably damaging 1.00
R2133:Dbt UTSW 3 116539124 missense probably damaging 1.00
R2897:Dbt UTSW 3 116523412 missense probably damaging 1.00
R3442:Dbt UTSW 3 116548191 missense probably benign
R4241:Dbt UTSW 3 116533296 missense probably damaging 1.00
R4681:Dbt UTSW 3 116533314 missense probably damaging 1.00
R4724:Dbt UTSW 3 116533296 missense probably damaging 1.00
R4736:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4737:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4738:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4740:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4809:Dbt UTSW 3 116546343 missense probably damaging 1.00
R4823:Dbt UTSW 3 116523387 missense probably damaging 1.00
R4861:Dbt UTSW 3 116548078 missense probably benign 0.00
R4861:Dbt UTSW 3 116548078 missense probably benign 0.00
R5148:Dbt UTSW 3 116528244 intron probably benign
R5327:Dbt UTSW 3 116528571 intron probably benign
R5700:Dbt UTSW 3 116520303 missense probably damaging 0.97
R6463:Dbt UTSW 3 116539760 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TTCCACCTCTGCTTGAGAAC -3'
(R):5'- GCTGAAGTAAAGAACAGACAGTT -3'

Sequencing Primer
(F):5'- TCCACCTCTGCTTGAGAACAAATTC -3'
(R):5'- TCAGCCTGGTCTACAAAGTG -3'
Posted On2017-12-01