Incidental Mutation 'R6035:Adgrb1'
ID501746
Institutional Source Beutler Lab
Gene Symbol Adgrb1
Ensembl Gene ENSMUSG00000034730
Gene Nameadhesion G protein-coupled receptor B1
SynonymsBai1, B830018M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6035 (G1)
Quality Score147.008
Status Not validated
Chromosome15
Chromosomal Location74516195-74589465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74540443 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 424 (T424S)
Ref Sequence ENSEMBL: ENSMUSP00000140362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000186360] [ENSMUST00000187485]
Predicted Effect probably benign
Transcript: ENSMUST00000042035
AA Change: T424S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: T424S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 4.69e-10 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 3.5e-9 SMART
TSP1 412 462 3.16e-16 SMART
TSP1 470 520 7.15e-15 SMART
TSP1 525 575 3.11e-15 SMART
HormR 577 643 2.55e-20 SMART
Pfam:GAIN 656 859 1e-46 PFAM
GPS 880 938 1.46e-18 SMART
Pfam:7tm_2 944 1180 3.3e-66 PFAM
SCOP:d1jvr__ 1396 1432 5e-4 SMART
low complexity region 1441 1455 N/A INTRINSIC
low complexity region 1545 1556 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186360
AA Change: T424S

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: T424S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 1.7e-11 SMART
TSP1 412 462 1.5e-18 SMART
TSP1 470 520 3.4e-17 SMART
TSP1 525 575 1.5e-17 SMART
HormR 577 643 1.6e-22 SMART
Pfam:DUF3497 653 874 1.2e-44 PFAM
GPS 880 938 8.9e-21 SMART
Pfam:7tm_2 944 1106 9.6e-43 PFAM
low complexity region 1113 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187485
SMART Domains Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189200
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 98.9%
  • 10x: 91.8%
  • 20x: 70.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G T 6: 121,638,394 G76W probably damaging Het
Abca17 A T 17: 24,281,245 F1324Y possibly damaging Het
Abca8b A T 11: 109,971,860 probably null Het
Abcc12 A G 8: 86,517,404 M1040T probably damaging Het
Abtb1 A G 6: 88,841,806 F7L probably damaging Het
Adcy9 T C 16: 4,304,513 T558A probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd31 C A 13: 96,832,213 P786Q probably benign Het
Arhgap39 G T 15: 76,737,224 Y392* probably null Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Carmil2 G T 8: 105,692,563 W749L probably benign Het
Ccar1 A G 10: 62,751,785 Y867H unknown Het
Cdh13 A G 8: 118,505,698 D47G probably benign Het
Chst9 T A 18: 15,452,853 T218S probably benign Het
Clec2i G A 6: 128,893,624 V67I probably benign Het
Cox7a2 T A 9: 79,759,746 probably benign Het
Cpz A G 5: 35,517,585 C107R probably damaging Het
Dapk1 T A 13: 60,761,199 C1209S possibly damaging Het
Ddx41 T C 13: 55,533,968 M307V probably benign Het
Defa24 A G 8: 21,734,549 I5V probably benign Het
Dgcr8 A T 16: 18,258,314 N2K probably damaging Het
Ebf2 A G 14: 67,238,974 D131G probably damaging Het
Fam149b C T 14: 20,377,917 R424C probably damaging Het
Fbln2 G A 6: 91,263,353 V714M probably damaging Het
Fgf5 T C 5: 98,275,526 Y257H probably damaging Het
Fmo3 A C 1: 162,964,036 V224G probably damaging Het
Gigyf2 T C 1: 87,410,728 I394T possibly damaging Het
Glmn T A 5: 107,593,880 probably null Het
Greb1l T C 18: 10,501,025 I385T possibly damaging Het
Grhl1 C A 12: 24,608,450 Q365K probably benign Het
Gsdme G A 6: 50,229,326 T179M probably damaging Het
Gtf2a1l A G 17: 88,711,534 T349A probably benign Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Il5ra G A 6: 106,741,265 T76I probably damaging Het
Itga8 T C 2: 12,191,714 T631A probably benign Het
Kcnh6 G A 11: 106,019,152 probably null Het
Krt26 C T 11: 99,333,589 E368K probably benign Het
Lhx9 T C 1: 138,838,543 D169G possibly damaging Het
Lman1l A G 9: 57,611,747 probably null Het
Lmod3 A G 6: 97,247,273 L529P probably damaging Het
Mroh2a G A 1: 88,230,668 V146M probably damaging Het
Nup155 A G 15: 8,144,093 T891A probably benign Het
Olfr20 T C 11: 73,353,756 M1T probably null Het
Olfr341 T A 2: 36,479,984 I49F probably damaging Het
Olfr409-ps1 T C 11: 74,317,459 *145R probably null Het
Olfr739 A G 14: 50,424,527 T3A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Papln G C 12: 83,774,680 G262A probably damaging Het
Pdcd1lg2 G A 19: 29,446,035 V160I probably benign Het
Pde8b A G 13: 95,027,597 probably benign Het
Ppme1 G A 7: 100,354,795 R68* probably null Het
Ptprn2 A T 12: 117,255,595 N949Y probably damaging Het
Qser1 C A 2: 104,787,123 D1115Y probably damaging Het
Rad54l G T 4: 116,097,469 D674E probably damaging Het
Ripk4 T A 16: 97,744,187 D420V probably damaging Het
Ros1 G T 10: 52,077,971 S1857R probably benign Het
Rsf1 A G 7: 97,662,109 E682G probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Samd4 G A 14: 47,087,872 R515H probably damaging Het
Selp T A 1: 164,141,510 W560R probably benign Het
Shc3 A T 13: 51,461,432 L163Q probably damaging Het
Shh G A 5: 28,461,399 A163V probably damaging Het
Slc17a8 T C 10: 89,592,075 R113G possibly damaging Het
Slc5a6 C A 5: 31,048,824 probably benign Het
Smarcd2 A G 11: 106,266,889 probably null Het
Sytl3 A G 17: 6,728,265 D148G probably damaging Het
Tnks G T 8: 34,918,461 H297Q possibly damaging Het
Trbv21 A T 6: 41,202,634 probably benign Het
Ube3c T C 5: 29,601,163 F268L probably benign Het
Ugt2b5 T C 5: 87,139,682 I209V probably benign Het
Usp1 A G 4: 98,929,845 N140S probably damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn1r129 T A 7: 21,360,609 Q228L probably damaging Het
Vmn1r209 T A 13: 22,806,032 N163Y probably benign Het
Vmn1r85 A G 7: 13,084,927 S97P probably damaging Het
Vmn2r30 C T 7: 7,334,351 M95I probably benign Het
Vmn2r74 G A 7: 85,951,890 R847C probably damaging Het
Wdr70 G A 15: 7,887,349 T529I possibly damaging Het
Zfp532 T G 18: 65,623,934 S313A possibly damaging Het
Zhx3 A T 2: 160,779,543 N901K probably benign Het
Other mutations in Adgrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Adgrb1 APN 15 74586835 missense probably damaging 1.00
IGL01748:Adgrb1 APN 15 74548357 splice site probably benign
IGL01874:Adgrb1 APN 15 74541574 missense possibly damaging 0.95
IGL02040:Adgrb1 APN 15 74541575 missense possibly damaging 0.91
IGL02138:Adgrb1 APN 15 74529782 missense probably damaging 1.00
IGL02149:Adgrb1 APN 15 74540477 missense probably damaging 1.00
IGL02320:Adgrb1 APN 15 74574112 missense probably damaging 1.00
IGL02556:Adgrb1 APN 15 74586805 missense probably damaging 0.99
IGL02637:Adgrb1 APN 15 74588294 splice site probably benign
IGL02678:Adgrb1 APN 15 74538328 missense probably damaging 0.99
IGL02792:Adgrb1 APN 15 74547622 missense probably damaging 0.98
bunting UTSW 15 74543701 missense probably null 0.94
R0193:Adgrb1 UTSW 15 74572156 missense probably damaging 1.00
R0208:Adgrb1 UTSW 15 74586807 missense probably benign
R0267:Adgrb1 UTSW 15 74529389 missense probably damaging 1.00
R0336:Adgrb1 UTSW 15 74587149 missense probably benign 0.06
R0345:Adgrb1 UTSW 15 74543349 missense probably damaging 0.97
R0533:Adgrb1 UTSW 15 74541559 missense probably damaging 1.00
R0635:Adgrb1 UTSW 15 74540892 missense possibly damaging 0.88
R0729:Adgrb1 UTSW 15 74548549 missense probably damaging 1.00
R0792:Adgrb1 UTSW 15 74580617 missense probably damaging 1.00
R1122:Adgrb1 UTSW 15 74547685 missense probably damaging 0.99
R1295:Adgrb1 UTSW 15 74550039 missense probably damaging 1.00
R1522:Adgrb1 UTSW 15 74580617 missense probably damaging 1.00
R1696:Adgrb1 UTSW 15 74588107 missense probably damaging 1.00
R1707:Adgrb1 UTSW 15 74529343 missense probably damaging 0.99
R1750:Adgrb1 UTSW 15 74541827 missense probably benign 0.23
R1804:Adgrb1 UTSW 15 74529540 missense probably damaging 1.00
R1829:Adgrb1 UTSW 15 74580586 nonsense probably null
R1895:Adgrb1 UTSW 15 74540465 missense probably damaging 1.00
R1970:Adgrb1 UTSW 15 74539877 splice site probably benign
R2114:Adgrb1 UTSW 15 74540562 critical splice donor site probably null
R2133:Adgrb1 UTSW 15 74529908 missense probably damaging 1.00
R2210:Adgrb1 UTSW 15 74547704 missense probably damaging 1.00
R3701:Adgrb1 UTSW 15 74545015 missense probably damaging 0.99
R3770:Adgrb1 UTSW 15 74588308 missense probably damaging 1.00
R3980:Adgrb1 UTSW 15 74582943 missense probably damaging 1.00
R4355:Adgrb1 UTSW 15 74543662 missense probably damaging 1.00
R4412:Adgrb1 UTSW 15 74577453 unclassified probably benign
R4634:Adgrb1 UTSW 15 74584429 utr 3 prime probably benign
R4683:Adgrb1 UTSW 15 74588114 missense probably damaging 1.00
R4742:Adgrb1 UTSW 15 74529479 nonsense probably null
R4760:Adgrb1 UTSW 15 74571463 missense probably damaging 1.00
R4794:Adgrb1 UTSW 15 74588129 missense probably damaging 1.00
R4880:Adgrb1 UTSW 15 74587022 missense possibly damaging 0.85
R4885:Adgrb1 UTSW 15 74572162 missense probably benign 0.04
R5092:Adgrb1 UTSW 15 74529815 missense probably benign 0.39
R5198:Adgrb1 UTSW 15 74543701 missense probably null 0.94
R5225:Adgrb1 UTSW 15 74577499 unclassified probably benign
R5421:Adgrb1 UTSW 15 74550027 missense probably damaging 1.00
R5764:Adgrb1 UTSW 15 74541574 missense possibly damaging 0.95
R5914:Adgrb1 UTSW 15 74538370 missense possibly damaging 0.54
R6035:Adgrb1 UTSW 15 74540443 missense possibly damaging 0.50
R6066:Adgrb1 UTSW 15 74540459 missense probably damaging 0.99
R6423:Adgrb1 UTSW 15 74588143 critical splice donor site probably null
R6811:Adgrb1 UTSW 15 74529361 missense probably damaging 1.00
R6945:Adgrb1 UTSW 15 74550024 missense probably damaging 0.99
Predicted Primers
Posted On2017-12-01