Incidental Mutation 'R6142:Col25a1'
ID501856
Institutional Source Beutler Lab
Gene Symbol Col25a1
Ensembl Gene ENSMUSG00000058897
Gene Namecollagen, type XXV, alpha 1
Synonyms2700062B08Rik
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location130131501-130599877 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 130583329 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080335] [ENSMUST00000106353] [ENSMUST00000183368]
Predicted Effect probably benign
Transcript: ENSMUST00000080335
SMART Domains Protein: ENSMUSP00000079210
Gene: ENSMUSG00000058897

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:Collagen 119 165 7e-9 PFAM
low complexity region 188 246 N/A INTRINSIC
low complexity region 275 288 N/A INTRINSIC
Pfam:Collagen 311 374 5.4e-11 PFAM
Pfam:Collagen 368 427 2e-9 PFAM
Pfam:Collagen 447 504 1.6e-10 PFAM
Pfam:Collagen 494 561 3.3e-8 PFAM
Pfam:Collagen 586 660 4.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106353
SMART Domains Protein: ENSMUSP00000101960
Gene: ENSMUSG00000058897

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:Collagen 119 174 1.7e-11 PFAM
Pfam:Collagen 183 244 6.2e-12 PFAM
Pfam:Collagen 233 297 7.5e-11 PFAM
Pfam:Collagen 294 345 1.8e-9 PFAM
Pfam:Collagen 343 399 1.1e-10 PFAM
Pfam:Collagen 419 475 1.9e-10 PFAM
low complexity region 490 525 N/A INTRINSIC
Pfam:Collagen 555 622 6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183368
SMART Domains Protein: ENSMUSP00000138875
Gene: ENSMUSG00000058897

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:Collagen 119 165 6.8e-9 PFAM
low complexity region 188 246 N/A INTRINSIC
internal_repeat_2 249 294 2.8e-5 PROSPERO
internal_repeat_1 294 308 4.06e-8 PROSPERO
Pfam:Collagen 309 372 2.1e-11 PFAM
Pfam:Collagen 371 427 3.7e-10 PFAM
Pfam:Collagen 447 496 7.7e-10 PFAM
low complexity region 497 506 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
low complexity region 556 571 N/A INTRINSIC
Meta Mutation Damage Score 0.1212 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a brain-specific membrane associated collagen. A product of proteolytic processing of the encoded protein, CLAC (collagenous Alzheimer amyloid plaque component), binds to amyloid beta-peptides found in Alzheimer amyloid plaques but CLAC inhibits rather than facilitates amyloid fibril elongation (PMID: 16300410). A study of over-expression of this collagen in mice, however, found changes in pathology and behavior suggesting that the encoded protein may promote amyloid plaque formation (PMID: 19548013). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, cyanosis and abnormal body curvature with apoptosis of phrenic nerve motor neurons and failure of diaphragm innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Col25a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Col25a1 APN 3 130181784 splice site probably benign
IGL00570:Col25a1 APN 3 130546432 splice site probably benign
IGL01651:Col25a1 APN 3 130566485 missense probably benign 0.06
IGL02033:Col25a1 APN 3 130388948 splice site probably benign
IGL02117:Col25a1 APN 3 130519773 splice site probably benign
IGL02290:Col25a1 APN 3 130519811 splice site probably benign
IGL03135:Col25a1 APN 3 130529683 splice site probably benign
R0526:Col25a1 UTSW 3 130476394 missense probably damaging 1.00
R0602:Col25a1 UTSW 3 130575414 splice site probably null
R0670:Col25a1 UTSW 3 130386895 missense possibly damaging 0.95
R0830:Col25a1 UTSW 3 130584726 missense probably damaging 1.00
R1220:Col25a1 UTSW 3 130388925 splice site probably benign
R1623:Col25a1 UTSW 3 130550050 missense probably damaging 1.00
R1818:Col25a1 UTSW 3 130585737 critical splice donor site probably null
R2142:Col25a1 UTSW 3 130570316 missense probably damaging 1.00
R2190:Col25a1 UTSW 3 130584715 missense probably damaging 1.00
R2901:Col25a1 UTSW 3 130546391 missense probably damaging 1.00
R2902:Col25a1 UTSW 3 130546391 missense probably damaging 1.00
R3703:Col25a1 UTSW 3 130550033 splice site probably null
R3818:Col25a1 UTSW 3 130550071 missense possibly damaging 0.88
R4726:Col25a1 UTSW 3 130519781 missense possibly damaging 0.92
R4775:Col25a1 UTSW 3 130182819 missense possibly damaging 0.96
R5036:Col25a1 UTSW 3 130583329 splice site probably null
R5110:Col25a1 UTSW 3 130584725 makesense probably null
R5501:Col25a1 UTSW 3 130595663 missense probably benign 0.07
R5686:Col25a1 UTSW 3 130564154 missense probably damaging 1.00
R5698:Col25a1 UTSW 3 130478983 critical splice acceptor site probably null
R6131:Col25a1 UTSW 3 130535465 missense probably damaging 1.00
R6549:Col25a1 UTSW 3 130182795 missense probably benign
R6624:Col25a1 UTSW 3 130566451 splice site probably null
R6898:Col25a1 UTSW 3 130584728 critical splice donor site probably null
R7030:Col25a1 UTSW 3 130479022 critical splice donor site probably null
R7114:Col25a1 UTSW 3 130595675 missense probably benign 0.06
R7172:Col25a1 UTSW 3 130570332 nonsense probably null
R7179:Col25a1 UTSW 3 130530119 missense probably damaging 0.99
R7488:Col25a1 UTSW 3 130584701 missense probably damaging 1.00
X0028:Col25a1 UTSW 3 130577318 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATTTCAGCAGTCATCTGGCAG -3'
(R):5'- ATTTGAGGCCGAGTATGATCTG -3'

Sequencing Primer
(F):5'- CTTCGTCACTACAGTCTTGAAGGAG -3'
(R):5'- CCGAGTATGATCTGTCTGTAGCAC -3'
Posted On2017-12-04