Incidental Mutation 'R6167:Myo18b'
ID501900
Institutional Source Beutler Lab
Gene Symbol Myo18b
Ensembl Gene ENSMUSG00000072720
Gene Namemyosin XVIIIb
Synonyms4932408L24Rik, 4933411E19Rik
MMRRC Submission 044313-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6167 (G1)
Quality Score164.009
Status Validated
Chromosome5
Chromosomal Location112688876-112896362 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 112872507 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086617]
Predicted Effect probably null
Transcript: ENSMUST00000086617
SMART Domains Protein: ENSMUSP00000083810
Gene: ENSMUSG00000072720

DomainStartEndE-ValueType
low complexity region 20 28 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 355 372 N/A INTRINSIC
low complexity region 377 419 N/A INTRINSIC
MYSc 605 1374 8.78e-30 SMART
IQ 1375 1397 5.92e-4 SMART
Pfam:Myosin_tail_1 1423 1875 5e-12 PFAM
low complexity region 1965 1985 N/A INTRINSIC
coiled coil region 2052 2126 N/A INTRINSIC
low complexity region 2184 2199 N/A INTRINSIC
low complexity region 2325 2336 N/A INTRINSIC
low complexity region 2408 2424 N/A INTRINSIC
low complexity region 2544 2558 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183029
Predicted Effect probably benign
Transcript: ENSMUST00000183273
Meta Mutation Damage Score 0.6064 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may regulate muscle-specific genes when in the nucleus and may influence intracellular trafficking when in the cytoplasm. The encoded protein functions as a homodimer and may interact with F actin. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with internal hemorrhage, pericaridal effusion, enlargement of the right atrium, and cardiac myofibril abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,292,105 E1042V probably benign Het
Ahnak2 T C 12: 112,783,122 E1035G probably benign Het
Aip T G 19: 4,115,188 D227A probably benign Het
Ankrd13d T C 19: 4,273,053 H283R probably damaging Het
Aox4 C T 1: 58,263,935 T1175I probably damaging Het
Atn1 T C 6: 124,746,737 probably benign Het
Camkk2 A G 5: 122,764,124 S41P probably damaging Het
Ceacam16 G A 7: 19,861,257 probably benign Het
Dcaf15 T C 8: 84,097,997 N524D possibly damaging Het
Dcaf7 A T 11: 106,037,251 Y43F probably damaging Het
Epha3 T C 16: 63,612,924 I453V probably benign Het
Etv1 A T 12: 38,865,641 T413S possibly damaging Het
Evx2 A C 2: 74,659,262 L53R probably damaging Het
Fam168b G A 1: 34,819,603 A166V probably damaging Het
Fancm A T 12: 65,094,895 Y430F probably benign Het
Fyb2 A G 4: 104,945,464 T188A possibly damaging Het
Gabbr1 T C 17: 37,063,379 I538T probably damaging Het
Glyctk T A 9: 106,156,492 T208S possibly damaging Het
Golga7 T C 8: 23,245,888 D114G probably damaging Het
Grip1 T C 10: 119,897,797 probably null Het
Gtf2f1 G T 17: 57,004,161 S351R probably damaging Het
Hook2 T C 8: 84,995,013 L300P probably damaging Het
Hsf4 A G 8: 105,270,849 S45G probably damaging Het
Iars T A 13: 49,722,714 M825K probably damaging Het
Kcnj2 A G 11: 111,072,489 I236V probably benign Het
Large2 G A 2: 92,367,088 T354I probably benign Het
Mak C A 13: 41,053,352 V101F probably benign Het
Mylk2 A G 2: 152,915,753 probably null Het
Neb T A 2: 52,147,237 H2955L probably benign Het
Neurl1a G C 19: 47,239,928 G71A probably damaging Het
Ogfrl1 A T 1: 23,376,228 L142Q probably damaging Het
Olfr387-ps1 A G 11: 73,665,334 T242A probably damaging Het
Olfr743 C A 14: 50,534,155 H248N probably damaging Het
P3h4 C A 11: 100,411,845 A322S probably damaging Het
Piwil2 A C 14: 70,422,893 probably null Het
Pkd2l2 A G 18: 34,428,244 D435G probably damaging Het
Plekha6 A G 1: 133,279,407 N567S probably null Het
Prss54 G A 8: 95,559,545 P300L possibly damaging Het
Pxdn G A 12: 29,974,001 R67Q probably damaging Het
Rapgef3 C A 15: 97,767,411 probably benign Het
Sec24b C T 3: 129,988,901 G1147S possibly damaging Het
Sh2b3 A T 5: 121,828,355 probably null Het
Sh3glb1 A T 3: 144,691,903 D358E probably damaging Het
Shmt2 C T 10: 127,517,862 R478H probably benign Het
Slc1a6 A G 10: 78,801,837 E399G probably benign Het
Slc22a23 T A 13: 34,344,559 Y80F probably damaging Het
Slc25a19 A G 11: 115,615,551 V272A probably benign Het
Stk32a A T 18: 43,313,409 D308V probably damaging Het
Tenm3 T C 8: 48,254,622 I1698V possibly damaging Het
Thoc5 G A 11: 4,915,497 V359M probably benign Het
Tmpo C T 10: 91,162,938 R329H probably benign Het
Trim8 T C 19: 46,515,187 S393P probably benign Het
Vill A T 9: 119,066,864 Y103F probably damaging Het
Zfp948 T G 17: 21,587,649 F368V probably benign Het
Zpld1 C T 16: 55,233,599 E277K probably damaging Het
Other mutations in Myo18b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Myo18b APN 5 112874131 missense probably benign 0.05
IGL00847:Myo18b APN 5 112830389 splice site probably benign
IGL00848:Myo18b APN 5 112871485 missense probably damaging 1.00
IGL00969:Myo18b APN 5 112875007 unclassified probably benign
IGL01018:Myo18b APN 5 112809747 missense probably damaging 1.00
IGL01448:Myo18b APN 5 112811704 missense probably damaging 1.00
IGL01490:Myo18b APN 5 112809700 missense possibly damaging 0.84
IGL01556:Myo18b APN 5 112757449 splice site probably benign
IGL01637:Myo18b APN 5 112840629 missense possibly damaging 0.82
IGL01819:Myo18b APN 5 112878050 missense unknown
IGL02007:Myo18b APN 5 112874972 unclassified probably benign
IGL02146:Myo18b APN 5 112843285 missense probably damaging 1.00
IGL02229:Myo18b APN 5 112878110 missense unknown
IGL02319:Myo18b APN 5 112791139 missense probably damaging 0.99
IGL02398:Myo18b APN 5 112830312 missense possibly damaging 0.92
IGL02420:Myo18b APN 5 112827986 missense possibly damaging 0.64
IGL02626:Myo18b APN 5 112878085 missense unknown
IGL02815:Myo18b APN 5 112809735 missense probably damaging 1.00
IGL02822:Myo18b APN 5 112775345 missense probably damaging 1.00
IGL02852:Myo18b APN 5 112715511 missense probably benign 0.03
IGL02995:Myo18b APN 5 112775413 splice site probably benign
IGL03019:Myo18b APN 5 112692397 missense probably benign 0.21
IGL03039:Myo18b APN 5 112840771 missense probably damaging 1.00
IGL03112:Myo18b APN 5 112873990 missense probably benign 0.02
IGL03123:Myo18b APN 5 112874938 unclassified probably benign
IGL03288:Myo18b APN 5 112789997 missense probably damaging 1.00
IGL03391:Myo18b APN 5 112874479 unclassified probably benign
R0271:Myo18b UTSW 5 112809685 missense possibly damaging 0.91
R0277:Myo18b UTSW 5 112693347 splice site probably benign
R0352:Myo18b UTSW 5 112874523 unclassified probably benign
R0504:Myo18b UTSW 5 112873576 unclassified probably benign
R0539:Myo18b UTSW 5 112723868 missense probably damaging 0.99
R0599:Myo18b UTSW 5 112865750 missense probably damaging 1.00
R0627:Myo18b UTSW 5 112798834 missense probably benign 0.38
R0659:Myo18b UTSW 5 112760327 missense possibly damaging 0.66
R0671:Myo18b UTSW 5 112692766 missense probably benign 0.00
R0847:Myo18b UTSW 5 112874488 unclassified probably benign
R1082:Myo18b UTSW 5 112760414 missense probably damaging 1.00
R1116:Myo18b UTSW 5 112803279 missense probably damaging 1.00
R1264:Myo18b UTSW 5 112830319 missense probably benign 0.12
R1280:Myo18b UTSW 5 112723805 critical splice donor site probably null
R1444:Myo18b UTSW 5 112775251 critical splice donor site probably null
R1446:Myo18b UTSW 5 112757559 missense probably damaging 1.00
R1470:Myo18b UTSW 5 112693033 missense probably damaging 1.00
R1470:Myo18b UTSW 5 112693033 missense probably damaging 1.00
R1590:Myo18b UTSW 5 112875266 nonsense probably null
R1601:Myo18b UTSW 5 112871498 missense possibly damaging 0.73
R1903:Myo18b UTSW 5 112692758 missense probably damaging 1.00
R1935:Myo18b UTSW 5 112760356 missense probably benign 0.04
R1936:Myo18b UTSW 5 112760356 missense probably benign 0.04
R2008:Myo18b UTSW 5 112873557 missense probably benign
R2127:Myo18b UTSW 5 112831078 missense probably damaging 1.00
R2129:Myo18b UTSW 5 112831078 missense probably damaging 1.00
R2141:Myo18b UTSW 5 112874026 missense probably benign 0.01
R2170:Myo18b UTSW 5 112723858 missense probably benign 0.23
R2258:Myo18b UTSW 5 112874663 unclassified probably benign
R2265:Myo18b UTSW 5 112782673 missense probably damaging 1.00
R2483:Myo18b UTSW 5 112858408 missense probably damaging 1.00
R2931:Myo18b UTSW 5 112693127 missense probably benign 0.01
R3160:Myo18b UTSW 5 112692728 missense probably damaging 0.99
R3162:Myo18b UTSW 5 112692728 missense probably damaging 0.99
R3777:Myo18b UTSW 5 112757596 missense probably damaging 0.99
R4240:Myo18b UTSW 5 112803187 critical splice donor site probably null
R4243:Myo18b UTSW 5 112692395 missense possibly damaging 0.95
R4245:Myo18b UTSW 5 112692395 missense possibly damaging 0.95
R4533:Myo18b UTSW 5 112693025 missense probably damaging 1.00
R4631:Myo18b UTSW 5 112846400 missense probably damaging 1.00
R4661:Myo18b UTSW 5 112875175 unclassified probably benign
R4755:Myo18b UTSW 5 112874474 nonsense probably null
R4771:Myo18b UTSW 5 112692227 nonsense probably null
R4812:Myo18b UTSW 5 112809718 missense possibly damaging 0.95
R4840:Myo18b UTSW 5 112874029 missense probably benign 0.02
R4888:Myo18b UTSW 5 112874480 unclassified probably benign
R4995:Myo18b UTSW 5 112760392 missense probably damaging 0.99
R5001:Myo18b UTSW 5 112761340 missense probably damaging 0.99
R5015:Myo18b UTSW 5 112790057 missense probably damaging 1.00
R5055:Myo18b UTSW 5 112875217 unclassified probably benign
R5070:Myo18b UTSW 5 112761346 missense probably damaging 1.00
R5105:Myo18b UTSW 5 112840778 missense probably damaging 1.00
R5121:Myo18b UTSW 5 112874480 unclassified probably benign
R5130:Myo18b UTSW 5 112873903 missense probably benign 0.06
R5186:Myo18b UTSW 5 112871470 missense probably damaging 1.00
R5437:Myo18b UTSW 5 112757573 missense possibly damaging 0.73
R5535:Myo18b UTSW 5 112790042 missense probably damaging 1.00
R5560:Myo18b UTSW 5 112868295 missense probably damaging 0.96
R5810:Myo18b UTSW 5 112834450 missense probably damaging 1.00
R5898:Myo18b UTSW 5 112802330 intron probably null
R6065:Myo18b UTSW 5 112692781 missense probably benign 0.00
R6104:Myo18b UTSW 5 112874291 unclassified probably benign
R6113:Myo18b UTSW 5 112866385 missense probably damaging 1.00
R6158:Myo18b UTSW 5 112874172 missense probably benign 0.01
R6220:Myo18b UTSW 5 112757507 missense possibly damaging 0.93
R6276:Myo18b UTSW 5 112811642 missense probably benign 0.31
R6290:Myo18b UTSW 5 112865735 missense possibly damaging 0.69
R6291:Myo18b UTSW 5 112865735 missense possibly damaging 0.69
R6795:Myo18b UTSW 5 112846364 missense probably damaging 0.99
R6798:Myo18b UTSW 5 112761386 missense probably damaging 0.98
R6817:Myo18b UTSW 5 112830238 missense probably benign 0.00
R6937:Myo18b UTSW 5 112802392 missense probably benign 0.12
R7034:Myo18b UTSW 5 112723904 nonsense probably null
R7097:Myo18b UTSW 5 112874405 missense not run
R7145:Myo18b UTSW 5 112817679 nonsense probably null
Z1088:Myo18b UTSW 5 112692943 missense possibly damaging 0.89
Z1088:Myo18b UTSW 5 112757484 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGAACGATCCCATGATGGAG -3'
(R):5'- AGCTTCCTGGACTGTCTCAG -3'

Sequencing Primer
(F):5'- AGCAGAGCCCTGAGTACCATG -3'
(R):5'- GTCTCAGAGACTCTACCCTTCC -3'
Posted On2017-12-04