Incidental Mutation 'R5861:Trim5'
ID501933
Institutional Source Beutler Lab
Gene Symbol Trim5
Ensembl Gene ENSMUSG00000060441
Gene Nametripartite motif-containing 5
Synonyms
MMRRC Submission 044073-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5861 (G1)
Quality Score24
Status Validated
Chromosome7
Chromosomal Location104263386-104288094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 104279521 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 71 (L71R)
Ref Sequence ENSEMBL: ENSMUSP00000095781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051795] [ENSMUST00000098179]
Predicted Effect probably benign
Transcript: ENSMUST00000051795
AA Change: L71R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050084
Gene: ENSMUSG00000060441
AA Change: L71R

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
coiled coil region 172 232 N/A INTRINSIC
Pfam:SPRY 349 485 9.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098179
AA Change: L71R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095781
Gene: ENSMUSG00000060441
AA Change: L71R

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
Pfam:SPRY 351 493 1.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138557
AA Change: L71R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119127
Gene: ENSMUSG00000060441
AA Change: L71R

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
coiled coil region 173 232 N/A INTRINSIC
Meta Mutation Damage Score 0.1264 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency 98% (81/83)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,298,812 D143G probably damaging Het
Abcc5 G T 16: 20,399,894 T246N probably damaging Het
Arhgap10 C T 8: 77,310,764 A612T probably damaging Het
Arsg T A 11: 109,563,188 F407I probably damaging Het
Asxl1 C A 2: 153,399,390 A620D probably damaging Het
BC080695 G T 4: 143,571,240 V77L probably benign Het
C2cd3 A G 7: 100,444,475 probably benign Het
Chn2 G A 6: 54,290,374 V92I probably damaging Het
Cog2 T C 8: 124,537,878 F332S probably damaging Het
Crhbp G A 13: 95,443,825 A82V probably damaging Het
Cyp2j6 A G 4: 96,545,803 V90A possibly damaging Het
Dennd4c A T 4: 86,791,352 M397L probably benign Het
Dnajb8 A G 6: 88,223,106 D208G possibly damaging Het
Ecm1 G C 3: 95,736,597 L230V probably damaging Het
Ercc2 G C 7: 19,394,141 A696P possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm13035 A G 4: 146,073,289 noncoding transcript Het
Gm28042 T C 2: 120,034,635 V247A probably damaging Het
Gm28455 T A 7: 39,498,579 noncoding transcript Het
Gpr150 A T 13: 76,056,073 V251D possibly damaging Het
Grip1 C T 10: 119,929,970 S69L probably damaging Het
Hs6st3 A G 14: 119,138,853 I147V possibly damaging Het
Il5 G A 11: 53,723,916 E102K probably benign Het
Kif1c T C 11: 70,703,795 F94L probably damaging Het
Lrrc63 T C 14: 75,107,366 E427G possibly damaging Het
Man1b1 A G 2: 25,348,054 T384A probably benign Het
Mapk15 C A 15: 75,996,359 probably benign Het
Mfsd10 T C 5: 34,634,244 probably benign Het
Mgat5 C A 1: 127,387,392 A285E probably damaging Het
Mroh4 T A 15: 74,606,607 probably benign Het
Myf5 A T 10: 107,484,208 C194S probably benign Het
Myh7 A G 14: 54,988,890 V431A possibly damaging Het
Nadsyn1 A C 7: 143,811,227 M247R possibly damaging Het
Nipsnap3b A G 4: 53,021,177 D166G probably damaging Het
Nqo2 A T 13: 33,972,430 L42F probably damaging Het
Nt5dc3 A T 10: 86,815,874 D180V probably damaging Het
Numa1 C A 7: 102,009,287 probably null Het
Olfm3 T A 3: 115,122,403 L328Q probably damaging Het
Olfr1141 A T 2: 87,753,578 N138K probably benign Het
Olfr1353 A T 10: 78,969,931 Y94F probably damaging Het
Olfr1508 T C 14: 52,463,496 Y171C probably damaging Het
Papolb T C 5: 142,529,237 N217S possibly damaging Het
Pcmtd2 C A 2: 181,842,475 T26K probably damaging Het
Pld5 T G 1: 176,090,005 N59H probably damaging Het
Ppm1d T C 11: 85,311,848 S126P possibly damaging Het
Ppp1r21 T C 17: 88,582,509 L727P probably damaging Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rara T A 11: 98,968,161 C148* probably null Het
Rexo2 A T 9: 48,475,181 I83N probably damaging Het
Rnf213 A G 11: 119,473,377 R4501G probably damaging Het
Rps5 T A 7: 12,925,574 F97L probably damaging Het
Sigirr G A 7: 141,091,379 R397W probably damaging Het
Slc6a6 T C 6: 91,741,033 Y318H probably damaging Het
Spam1 A G 6: 24,796,571 T174A probably benign Het
Stam2 G T 2: 52,742,104 probably benign Het
Taar7a T C 10: 23,992,439 E348G probably benign Het
Taf11 T C 17: 27,901,670 T209A probably benign Het
Tenm4 A G 7: 96,843,217 probably benign Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Uevld A T 7: 46,926,356 S461T probably benign Het
Vmn2r6 T A 3: 64,556,033 N460I probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zfp316 T C 5: 143,263,340 Y180C unknown Het
Zfp941 A G 7: 140,812,139 S436P probably damaging Het
Zfp979 G A 4: 147,613,509 Q248* probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Trim5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01702:Trim5 APN 7 104279431 missense probably damaging 1.00
IGL02165:Trim5 APN 7 104279359 missense probably damaging 1.00
IGL02576:Trim5 APN 7 104278417 missense probably damaging 0.97
IGL02660:Trim5 APN 7 104266218 missense probably damaging 0.96
IGL02732:Trim5 APN 7 104278465 missense probably benign 0.02
R0278:Trim5 UTSW 7 104279675 missense probably benign 0.00
R0373:Trim5 UTSW 7 104265684 missense probably benign 0.00
R0508:Trim5 UTSW 7 104265604 missense probably null 0.98
R0840:Trim5 UTSW 7 104265771 missense probably damaging 1.00
R0947:Trim5 UTSW 7 104265751 missense probably damaging 1.00
R1432:Trim5 UTSW 7 104279519 missense probably benign 0.04
R1432:Trim5 UTSW 7 104279521 missense probably benign
R1770:Trim5 UTSW 7 104276661 missense probably damaging 1.00
R1782:Trim5 UTSW 7 104265816 unclassified probably null
R1988:Trim5 UTSW 7 104265621 missense probably damaging 0.99
R2140:Trim5 UTSW 7 104276791 nonsense probably null
R3110:Trim5 UTSW 7 104279638 missense probably damaging 1.00
R3112:Trim5 UTSW 7 104279638 missense probably damaging 1.00
R3893:Trim5 UTSW 7 104276835 missense probably damaging 0.98
R3948:Trim5 UTSW 7 104266520 nonsense probably null
R4114:Trim5 UTSW 7 104265740 missense probably damaging 0.99
R4249:Trim5 UTSW 7 104276815 missense possibly damaging 0.83
R4352:Trim5 UTSW 7 104276808 missense probably damaging 1.00
R4595:Trim5 UTSW 7 104265432 missense probably damaging 1.00
R5057:Trim5 UTSW 7 104265423 missense probably damaging 1.00
R5583:Trim5 UTSW 7 104276835 missense probably damaging 0.98
R5861:Trim5 UTSW 7 104279519 missense probably benign 0.04
R7027:Trim5 UTSW 7 104265668 missense probably benign 0.00
R7078:Trim5 UTSW 7 104278474 missense possibly damaging 0.85
R7150:Trim5 UTSW 7 104276810 missense probably damaging 0.96
Z1088:Trim5 UTSW 7 104266225 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CCACCTCTTCAATGAGAGCTG -3'
(R):5'- CACAGCAACTATGGCTTCAC -3'

Sequencing Primer
(F):5'- ACCTCTTCAATGAGAGCTGTTTTG -3'
(R):5'- CAGCAACTATGGCTTCACAATTCATG -3'
Posted On2018-01-08