Incidental Mutation 'R5883:Bmf'
List |< first << previous [record 20 of 217] next >> last >|
ID501939
Institutional Source Beutler Lab
Gene Symbol Bmf
Ensembl Gene ENSMUSG00000040093
Gene NameBCL2 modifying factor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5883 (G1)
Quality Score34
Status Validated
Chromosome2
Chromosomal Location118528757-118549687 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) C to T at 118546966 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090219] [ENSMUST00000110859]
Predicted Effect silent
Transcript: ENSMUST00000090219
SMART Domains Protein: ENSMUSP00000087686
Gene: ENSMUSG00000040093

DomainStartEndE-ValueType
low complexity region 24 36 N/A INTRINSIC
Pfam:BMF 84 270 1.9e-69 PFAM
Predicted Effect silent
Transcript: ENSMUST00000110859
SMART Domains Protein: ENSMUSP00000106483
Gene: ENSMUSG00000040093

DomainStartEndE-ValueType
Pfam:BMF 7 190 1.9e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154521
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.9%
  • 20x: 83.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein contains a single BCL2 homology domain 3 (BH3), and has been shown to bind BCL2 proteins and function as an apoptotic activator. This protein is found to be sequestered to myosin V motors by its association with dynein light chain 2, which may be important for sensing intracellular damage and triggering apoptosis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted knockout mutations show enlarged spleen, increased B cells and CD8-positive T cells, decreased B cells and T cells apoptosis, vagina atresia and hydrometrocolpos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,145,641 V103I probably damaging Het
Aass G A 6: 23,072,994 T920I probably benign Het
Akirin2 A G 4: 34,565,256 I168V possibly damaging Het
Ambn T A 5: 88,467,829 Y372* probably null Het
Ano3 T A 2: 110,880,864 E85V probably null Het
Bmper T A 9: 23,406,674 S530T probably benign Het
Bop1 T C 15: 76,454,849 D383G probably damaging Het
Bub1b T A 2: 118,609,882 Y156N probably damaging Het
Cacna1h A G 17: 25,376,922 V1987A probably benign Het
Cd84 T C 1: 171,872,838 V174A possibly damaging Het
Cep290 T A 10: 100,523,399 L997Q probably benign Het
Chil4 C T 3: 106,210,570 R128H possibly damaging Het
Cpne3 A T 4: 19,552,314 V106D possibly damaging Het
D6Wsu163e A G 6: 126,966,916 E425G probably damaging Het
Dlgap1 A T 17: 70,517,013 probably benign Het
Dnhd1 C A 7: 105,720,504 H4379N probably damaging Het
Gm10309 A G 17: 86,498,757 probably benign Het
Gm6264 G A 1: 85,171,182 probably benign Het
Has2 T A 15: 56,668,063 I419F possibly damaging Het
Hscb A G 5: 110,839,578 C51R probably benign Het
Ighv1-61 T C 12: 115,359,563 S4G probably benign Het
Islr2 G T 9: 58,198,715 Q465K probably benign Het
Jakmip2 T C 18: 43,581,994 I156V possibly damaging Het
Klk1b24 A G 7: 44,190,363 I49V probably benign Het
Krt90 C T 15: 101,553,219 probably benign Het
Larp1 C T 11: 58,042,299 S243F probably damaging Het
Lrp4 T C 2: 91,488,433 Y872H probably benign Het
Maip1 T C 1: 57,407,101 M110T probably damaging Het
March7 G A 2: 60,234,442 R354Q probably damaging Het
Med12l G T 3: 59,091,468 E605D probably damaging Het
Nt5c1a T A 4: 123,216,256 probably null Het
Olfr209 A T 16: 59,361,715 C168S probably damaging Het
Olfr490 C T 7: 108,286,244 S294N probably damaging Het
Olfr531 T A 7: 140,400,188 Y286F probably damaging Het
Pdzd9 T A 7: 120,668,553 E13V possibly damaging Het
Ppip5k2 C T 1: 97,707,810 A1100T possibly damaging Het
Prkdc C A 16: 15,715,914 Q1539K probably benign Het
Rad54l C G 4: 116,099,046 probably benign Het
Ric1 T A 19: 29,595,989 I943N probably damaging Het
Rif1 T A 2: 52,105,639 probably null Het
Rpl12 T C 2: 32,962,524 probably benign Het
Ryr3 T C 2: 113,030,292 probably benign Het
Scarb1 C A 5: 125,340,907 probably benign Het
Sox10 T C 15: 79,156,263 E359G probably damaging Het
Taf5 A G 19: 47,067,789 T9A unknown Het
Tmem128 C T 5: 38,266,541 A33V possibly damaging Het
Tox A C 4: 6,697,444 V453G probably benign Het
Ubxn4 T A 1: 128,256,130 C76S probably damaging Het
Vmn2r100 A T 17: 19,523,524 Y483F probably benign Het
Xkr5 A G 8: 18,940,790 S154P probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Other mutations in Bmf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Bmf APN 2 118549158 missense probably benign 0.00
R0009:Bmf UTSW 2 118549622 missense probably damaging 0.98
R4180:Bmf UTSW 2 118532537 utr 3 prime probably benign
R4598:Bmf UTSW 2 118549128 missense probably benign 0.00
R4685:Bmf UTSW 2 118546802 missense probably damaging 1.00
R5921:Bmf UTSW 2 118532553 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- AAGAGTCTCTGGGGTTCCTCTG -3'
(R):5'- AAGTTGGCTTGGTTCCCTC -3'

Sequencing Primer
(F):5'- AGCATGACACCCTGGCTTG -3'
(R):5'- GGCTTGGTTCCCTCACATAAGAAG -3'
Posted On2018-01-10