Incidental Mutation 'R5661:Hjurp'
ID501942
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene NameHolliday junction recognition protein
Synonyms
MMRRC Submission 043304-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R5661 (G1)
Quality Score34
Status Validated
Chromosome1
Chromosomal Location88262471-88277633 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to C at 88277215 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000065420] [ENSMUST00000147393]
Predicted Effect probably benign
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128532
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148138
Meta Mutation Damage Score 0.0948 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 A G 6: 83,520,772 I166T probably damaging Het
Actn1 T C 12: 80,184,844 E273G probably benign Het
Arhgap15 G A 2: 44,322,727 R403H possibly damaging Het
Arhgef26 T C 3: 62,377,654 probably benign Het
Avl9 A T 6: 56,725,102 R81* probably null Het
Brd3 G A 2: 27,461,572 T223I possibly damaging Het
Cacna2d4 T C 6: 119,343,531 M890T probably benign Het
Carm1 A G 9: 21,586,999 D433G probably benign Het
Ccdc40 A G 11: 119,237,927 K427E probably benign Het
Ccdc80 T C 16: 45,127,445 Y929H probably damaging Het
Ccr9 A C 9: 123,780,099 Y282S probably benign Het
Det1 C T 7: 78,843,210 E349K probably damaging Het
Enpep T A 3: 129,276,757 N834Y probably damaging Het
Epha7 A T 4: 28,946,217 probably null Het
Fap A T 2: 62,536,963 probably benign Het
Foxn4 A G 5: 114,272,992 C23R probably benign Het
Gad1-ps T C 10: 99,445,039 noncoding transcript Het
Gli2 C A 1: 118,853,302 E238* probably null Het
Gm20939 C A 17: 94,875,779 H148N probably damaging Het
Gnl1 T C 17: 35,982,555 Y211H probably benign Het
Gpat3 A T 5: 100,885,942 K221* probably null Het
Hnrnph1 A T 11: 50,384,680 Q415L probably benign Het
Kansl3 T C 1: 36,348,957 E383G possibly damaging Het
Kdm5b T C 1: 134,599,073 V311A probably benign Het
Lipk T A 19: 34,032,327 M215K probably benign Het
Madd A G 2: 91,154,433 probably null Het
Meltf A G 16: 31,881,926 E88G possibly damaging Het
Mis18bp1 A T 12: 65,148,852 S713T probably benign Het
Mocos T A 18: 24,665,995 probably null Het
Msto1 T A 3: 88,912,885 D88V possibly damaging Het
Myo5a A G 9: 75,167,206 Y799C probably benign Het
Nectin4 T A 1: 171,385,170 L357H probably damaging Het
Olfr1184 G A 2: 88,487,097 V122M probably damaging Het
Olfr791 A T 10: 129,526,749 H174L probably benign Het
Pax2 A G 19: 44,790,722 N179S probably damaging Het
Pcdhac2 C A 18: 37,145,446 T493K probably damaging Het
Pgk2 G T 17: 40,207,396 C380* probably null Het
Pi4k2b G A 5: 52,743,564 probably null Het
Plcb3 A G 19: 6,963,220 V416A probably damaging Het
Pom121l2 G A 13: 21,984,255 G899R possibly damaging Het
Ppp4r1 T C 17: 65,803,968 probably null Het
Prkdc G A 16: 15,810,770 E3460K possibly damaging Het
Psmb3 A G 11: 97,706,833 E75G possibly damaging Het
Retnlb C T 16: 48,818,066 T50I probably benign Het
Sec16a A G 2: 26,439,637 S789P probably benign Het
Sec24d C T 3: 123,343,085 T489I probably damaging Het
Sec24d T C 3: 123,343,142 M508T possibly damaging Het
Slc5a8 C T 10: 88,919,428 L466F possibly damaging Het
Terf1 T A 1: 15,819,664 V221E probably damaging Het
Trak1 A G 9: 121,443,637 N187S possibly damaging Het
Trappc11 T A 8: 47,512,607 D528V probably damaging Het
Vmn1r170 A G 7: 23,606,806 N211S possibly damaging Het
Zcchc11 A G 4: 108,513,187 D761G probably benign Het
Zfpm2 G A 15: 41,096,071 W50* probably null Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88270269 missense probably benign 0.04
IGL03099:Hjurp APN 1 88266289 missense probably benign 0.09
IGL03097:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88266280 utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266046 missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266561 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266616 missense probably benign 0.04
PIT4378001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R0053:Hjurp UTSW 1 88277215 splice site probably benign
R0371:Hjurp UTSW 1 88277368 splice site probably benign
R0442:Hjurp UTSW 1 88266524 nonsense probably null
R0762:Hjurp UTSW 1 88277215 splice site probably benign
R0928:Hjurp UTSW 1 88266524 nonsense probably null
R1333:Hjurp UTSW 1 88266046 missense probably damaging 0.98
R1342:Hjurp UTSW 1 88277368 splice site probably benign
R1364:Hjurp UTSW 1 88266525 frame shift probably null
R1496:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88266121 missense probably benign 0.03
R1905:Hjurp UTSW 1 88266616 missense probably benign 0.04
R1965:Hjurp UTSW 1 88266524 nonsense probably null
R1992:Hjurp UTSW 1 88266524 nonsense probably null
R2002:Hjurp UTSW 1 88266524 nonsense probably null
R2023:Hjurp UTSW 1 88266524 nonsense probably null
R2024:Hjurp UTSW 1 88266524 nonsense probably null
R2332:Hjurp UTSW 1 88277215 splice site probably benign
R2420:Hjurp UTSW 1 88266524 nonsense probably null
R2422:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R2869:Hjurp UTSW 1 88266524 nonsense probably null
R2870:Hjurp UTSW 1 88266524 nonsense probably null
R2871:Hjurp UTSW 1 88266524 nonsense probably null
R2872:Hjurp UTSW 1 88266524 nonsense probably null
R3019:Hjurp UTSW 1 88266524 nonsense probably null
R3021:Hjurp UTSW 1 88266524 nonsense probably null
R3150:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R3411:Hjurp UTSW 1 88266524 nonsense probably null
R3552:Hjurp UTSW 1 88266524 nonsense probably null
R3704:Hjurp UTSW 1 88277215 splice site probably benign
R3730:Hjurp UTSW 1 88266524 nonsense probably null
R3733:Hjurp UTSW 1 88266524 nonsense probably null
R3764:Hjurp UTSW 1 88266524 nonsense probably null
R3799:Hjurp UTSW 1 88277215 splice site probably benign
R3819:Hjurp UTSW 1 88277215 splice site probably benign
R3857:Hjurp UTSW 1 88266524 nonsense probably null
R3930:Hjurp UTSW 1 88266524 nonsense probably null
R3952:Hjurp UTSW 1 88277215 splice site probably benign
R4090:Hjurp UTSW 1 88277215 splice site probably benign
R4159:Hjurp UTSW 1 88277215 splice site probably benign
R4207:Hjurp UTSW 1 88277215 splice site probably benign
R4322:Hjurp UTSW 1 88277215 splice site probably benign
R4391:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4392:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4397:Hjurp UTSW 1 88266524 nonsense probably null
R4700:Hjurp UTSW 1 88266524 nonsense probably null
R4808:Hjurp UTSW 1 88277215 splice site probably benign
R4900:Hjurp UTSW 1 88266524 nonsense probably null
R4901:Hjurp UTSW 1 88266524 nonsense probably null
R5023:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88266524 nonsense probably null
R5123:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88266524 nonsense probably null
R5300:Hjurp UTSW 1 88266524 nonsense probably null
R5318:Hjurp UTSW 1 88266524 nonsense probably null
R5370:Hjurp UTSW 1 88266524 nonsense probably null
R5410:Hjurp UTSW 1 88266524 nonsense probably null
R5445:Hjurp UTSW 1 88266316 missense probably benign 0.43
R5457:Hjurp UTSW 1 88266525 frame shift probably null
R5497:Hjurp UTSW 1 88266320 missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88266524 nonsense probably null
R5561:Hjurp UTSW 1 88266524 nonsense probably null
R5615:Hjurp UTSW 1 88266524 nonsense probably null
R5722:Hjurp UTSW 1 88266524 nonsense probably null
R6087:Hjurp UTSW 1 88266524 nonsense probably null
R6089:Hjurp UTSW 1 88266524 nonsense probably null
R6090:Hjurp UTSW 1 88266524 nonsense probably null
R6125:Hjurp UTSW 1 88266524 nonsense probably null
R6175:Hjurp UTSW 1 88266524 nonsense probably null
R6362:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88266524 nonsense probably null
R7016:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R7016:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7045:Hjurp UTSW 1 88266278 utr 3 prime probably benign
V5622:Hjurp UTSW 1 88277525 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCTCGAACTTCCATGCCAG -3'
(R):5'- TAAGGAAAGCAGTAGCCGCTTC -3'

Sequencing Primer
(F):5'- ACTCAGGGATTCAAGGTC -3'
(R):5'- AGTAGCCGCTTCCAGACGTTAATG -3'
Posted On2018-01-19