Incidental Mutation 'R5776:Gfer'
ID501949
Institutional Source Beutler Lab
Gene Symbol Gfer
Ensembl Gene ENSMUSG00000040888
Gene Namegrowth factor, augmenter of liver regeneration
SynonymsERV1, Alr
MMRRC Submission 043375-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R5776 (G1)
Quality Score77
Status Validated
Chromosome17
Chromosomal Location24693191-24696156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24696053 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 5 (S5R)
Ref Sequence ENSEMBL: ENSMUSP00000049186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019464] [ENSMUST00000046839] [ENSMUST00000126319]
Predicted Effect probably benign
Transcript: ENSMUST00000019464
SMART Domains Protein: ENSMUSP00000019464
Gene: ENSMUSG00000019320

DomainStartEndE-ValueType
PX 6 122 1.36e-2 SMART
SH3 160 218 1.55e0 SMART
SH3 234 289 1.8e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000046534
Predicted Effect probably benign
Transcript: ENSMUST00000046839
AA Change: S5R

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049186
Gene: ENSMUSG00000040888
AA Change: S5R

DomainStartEndE-ValueType
low complexity region 33 47 N/A INTRINSIC
low complexity region 48 54 N/A INTRINSIC
Pfam:Evr1_Alr 97 189 2.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124864
Predicted Effect probably benign
Transcript: ENSMUST00000126319
SMART Domains Protein: ENSMUSP00000120911
Gene: ENSMUSG00000040688

DomainStartEndE-ValueType
WD40 54 94 3.08e0 SMART
WD40 97 137 2.38e-6 SMART
WD40 140 181 3.85e-1 SMART
WD40 184 223 6.94e-8 SMART
WD40 237 275 7.36e1 SMART
WD40 278 320 3.07e1 SMART
WD40 323 363 1.78e0 SMART
WD40 365 404 1.17e-5 SMART
WD40 410 450 8.16e-5 SMART
WD40 468 507 5.18e-7 SMART
WD40 510 549 8.1e-9 SMART
WD40 552 591 8.55e-8 SMART
WD40 594 633 2.93e-6 SMART
low complexity region 637 650 N/A INTRINSIC
Pfam:Utp13 654 788 3.7e-43 PFAM
low complexity region 792 800 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126342
Predicted Effect probably benign
Transcript: ENSMUST00000130633
SMART Domains Protein: ENSMUSP00000117818
Gene: ENSMUSG00000040688

DomainStartEndE-ValueType
WD40 2 38 8.75e-5 SMART
WD40 41 80 8.1e-9 SMART
WD40 90 129 9.52e-6 SMART
WD40 132 171 2.93e-6 SMART
low complexity region 175 188 N/A INTRINSIC
Pfam:Utp13 192 299 1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152527
Meta Mutation Damage Score 0.1256 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The hepatotrophic factor designated augmenter of liver regeneration (ALR) is thought to be one of the factors responsible for the extraordinary regenerative capacity of mammalian liver. It has also been called hepatic regenerative stimulation substance (HSS). The gene resides on chromosome 16 in the interval containing the locus for polycystic kidney disease (PKD1). The putative gene product is 42% similar to the scERV1 protein of yeast. The yeast scERV1 gene had been found to be essential for oxidative phosphorylation, the maintenance of mitochondrial genomes, and the cell division cycle. The human gene is both the structural and functional homolog of the yeast scERV1 gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before E9.5. Mice homozygous for a different knock-out allele are embryonic lethal, while heterozygotes display impaired mitochondrial biogenesis and decreased liver degeneration following partial hepatectomy or acute liver injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,107,650 M378K possibly damaging Het
Abca17 A G 17: 24,295,158 V857A probably benign Het
Abca9 C T 11: 110,107,460 probably null Het
Adam22 T C 5: 8,127,361 K583E probably benign Het
Akr1c13 T C 13: 4,194,187 F80L probably damaging Het
Apob A T 12: 8,006,149 I1511F possibly damaging Het
Cfh C A 1: 140,144,023 R291I possibly damaging Het
Col1a1 C T 11: 94,949,724 S1114F unknown Het
Ctsj T C 13: 61,003,142 D168G probably damaging Het
Erf T C 7: 25,246,109 D79G probably damaging Het
Extl1 T C 4: 134,357,772 N629S possibly damaging Het
Fbxo9 T C 9: 78,095,187 E204G probably damaging Het
Fdx1l C A 9: 21,073,482 V9L possibly damaging Het
Gm15931 A T 7: 4,281,565 noncoding transcript Het
Gm6309 T A 5: 146,168,881 I158F possibly damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm8251 T C 1: 44,056,505 E1811G possibly damaging Het
Hacl1 A T 14: 31,622,871 N234K possibly damaging Het
Hcn3 C T 3: 89,148,105 A612T probably benign Het
Hectd1 T A 12: 51,764,114 E1679D possibly damaging Het
Hipk4 T C 7: 27,528,980 L285P probably damaging Het
Igsf3 G A 3: 101,425,480 V25I probably benign Het
Jade1 A G 3: 41,613,792 H765R probably benign Het
Kcnv1 T C 15: 45,114,567 D25G unknown Het
Klhl3 A G 13: 58,005,184 S586P probably benign Het
L3mbtl2 A G 15: 81,684,871 D582G probably damaging Het
Matn2 G A 15: 34,431,619 C835Y probably damaging Het
Mgea5 T C 19: 45,771,924 E265G probably damaging Het
Naa15 A C 3: 51,460,026 D490A probably damaging Het
Nab2 T A 10: 127,664,329 Y298F probably damaging Het
Nipsnap1 T A 11: 4,888,919 M115K probably benign Het
Nlrp5-ps T C 7: 14,592,724 noncoding transcript Het
Nol4l T G 2: 153,417,821 Q211P probably damaging Het
Olfr427 A T 1: 174,099,773 H105L probably damaging Het
Olfr625-ps1 T A 7: 103,683,039 M97K probably damaging Het
Pkhd1 T C 1: 20,209,185 K2970E possibly damaging Het
Plin4 T C 17: 56,104,983 T683A probably damaging Het
Ppm1g T C 5: 31,205,110 D282G probably benign Het
Ppp6r3 A G 19: 3,526,901 S10P possibly damaging Het
Raph1 G A 1: 60,490,156 probably benign Het
Rc3h2 A G 2: 37,378,313 V935A possibly damaging Het
Reg4 T A 3: 98,233,028 D108E possibly damaging Het
Saraf T A 8: 34,165,450 Y228N probably damaging Het
Sctr T C 1: 120,056,407 S357P probably damaging Het
Sec22b A T 3: 97,914,568 N139Y probably damaging Het
Sgsm1 T A 5: 113,250,957 I1037F probably damaging Het
Skint5 A C 4: 113,763,503 S671R unknown Het
Slc38a3 C A 9: 107,658,749 E62* probably null Het
Slfn14 C T 11: 83,283,599 E189K probably damaging Het
Sox21 A G 14: 118,235,244 L131P probably damaging Het
Stip1 A G 19: 7,022,025 probably null Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Susd1 T C 4: 59,315,363 probably benign Het
Tdrd7 T A 4: 46,005,689 D498E probably benign Het
Tln2 C T 9: 67,258,250 E1053K probably damaging Het
Trav6-4 A G 14: 53,454,754 D103G probably damaging Het
Txndc15 A G 13: 55,718,107 E128G probably benign Het
Vmn2r22 A T 6: 123,637,714 W306R probably damaging Het
Yjefn3 A T 8: 69,889,471 L33Q probably damaging Het
Zfp641 T C 15: 98,289,010 D244G probably damaging Het
Other mutations in Gfer
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Gfer APN 17 24695929 missense probably benign 0.01
IGL02898:Gfer APN 17 24695947 missense probably benign
R0242:Gfer UTSW 17 24694303 missense probably damaging 1.00
R0242:Gfer UTSW 17 24694303 missense probably damaging 1.00
R1640:Gfer UTSW 17 24695363 missense possibly damaging 0.95
R4898:Gfer UTSW 17 24695300 missense probably damaging 0.98
R7024:Gfer UTSW 17 24695968 missense probably damaging 1.00
R7203:Gfer UTSW 17 24695862 missense probably damaging 1.00
X0020:Gfer UTSW 17 24695253 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CATCCACGACTTGAAGTCCACG -3'
(R):5'- ACACACTTCACATCTGCCGG -3'

Sequencing Primer
(F):5'- ACTTGAAGTCCACGCAGGC -3'
(R):5'- GTCACCAGGCGCAAGAGTAC -3'
Posted On2018-01-23