Incidental Mutation 'R5889:Stard3'
ID501972
Institutional Source Beutler Lab
Gene Symbol Stard3
Ensembl Gene ENSMUSG00000018167
Gene NameSTART domain containing 3
Synonymses64, Mln64
MMRRC Submission 044090-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5889 (G1)
Quality Score21
Status Validated
Chromosome11
Chromosomal Location98358368-98381112 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 98375535 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 120 (Q120H)
Ref Sequence ENSEMBL: ENSMUSP00000018311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018311]
Predicted Effect probably benign
Transcript: ENSMUST00000018311
AA Change: Q120H

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000018311
Gene: ENSMUSG00000018167
AA Change: Q120H

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
Pfam:MENTAL 48 214 1.1e-65 PFAM
START 240 445 4.43e-67 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155063
Meta Mutation Damage Score 0.1108 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of lipid trafficking proteins that are characterized by a C-terminal steroidogenic acute regulatory domain and an N-terminal metastatic lymph node 64 domain. The encoded protein localizes to the membranes of late endosomes and may be involved in exporting cholesterol. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a truncated allele are viable and fertile and display mild defects in cholesterol metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,449 E297G probably damaging Het
Astn1 C T 1: 158,600,380 P707L possibly damaging Het
Cep290 T C 10: 100,499,074 S319P possibly damaging Het
Chrna4 A C 2: 181,028,658 L435W probably damaging Het
Cilp C A 9: 65,280,343 A1240D possibly damaging Het
Col17a1 A G 19: 47,649,072 F1249S possibly damaging Het
Creb3l3 T C 10: 81,092,533 probably benign Het
Cyp4f40 C A 17: 32,675,757 T432N probably benign Het
Dsg1c T G 18: 20,283,601 I853R possibly damaging Het
Ebna1bp2 T A 4: 118,621,423 D34E probably damaging Het
Edc4 C T 8: 105,888,022 T112I possibly damaging Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Exoc6 A G 19: 37,582,245 H291R probably damaging Het
Fbln5 G T 12: 101,765,226 N236K probably damaging Het
Fndc8 A T 11: 82,898,729 T238S probably damaging Het
Frem3 T C 8: 80,614,288 V1070A probably damaging Het
Gabra4 A T 5: 71,571,891 N515K possibly damaging Het
Gemin5 A G 11: 58,122,355 V1422A possibly damaging Het
Gm10118 A G 10: 63,927,111 probably benign Het
Grm5 A G 7: 87,603,073 D177G probably damaging Het
Gtf2h4 G A 17: 35,670,900 P147L possibly damaging Het
Hgsnat T C 8: 25,963,367 D265G probably damaging Het
Hsd17b4 T A 18: 50,177,209 L513Q probably damaging Het
Hsd17b7 A T 1: 169,955,918 M307K probably benign Het
Hspa5 T C 2: 34,774,617 V361A probably damaging Het
Iqgap2 A G 13: 95,632,042 V1450A probably benign Het
Itpr3 A G 17: 27,115,065 E2037G probably damaging Het
Lama5 T C 2: 180,193,674 probably benign Het
Manba G T 3: 135,524,598 G311* probably null Het
Mettl24 T A 10: 40,746,490 V236E probably benign Het
Myh3 A G 11: 67,086,375 D310G probably damaging Het
Ncoa4 A T 14: 32,166,659 probably benign Het
Nop56 G T 2: 130,275,982 R126L probably damaging Het
Nos3 C A 5: 24,368,777 probably benign Het
Olfr156 T C 4: 43,820,492 M290V possibly damaging Het
Pcdhga3 T A 18: 37,676,609 V705D probably damaging Het
Prom2 C T 2: 127,529,411 A776T possibly damaging Het
Prss48 A G 3: 85,998,185 I127T probably damaging Het
Rtca T C 3: 116,499,583 Y193C possibly damaging Het
Samd9l T C 6: 3,376,460 Y267C probably damaging Het
Scube3 A G 17: 28,160,913 R272G possibly damaging Het
Sprr1a G T 3: 92,484,644 H17N probably benign Het
Ssfa2 T A 2: 79,657,728 D718E probably damaging Het
Supt6 A G 11: 78,212,748 I1377T probably damaging Het
Svop A T 5: 114,065,631 S30T probably benign Het
Syne2 T A 12: 76,072,252 L5882* probably null Het
Tanc2 G T 11: 105,921,807 R1359L probably benign Het
Tmc7 A C 7: 118,566,326 L55R probably benign Het
Trappc11 G A 8: 47,519,578 A320V probably benign Het
Ttll8 G C 15: 88,933,939 P178A probably damaging Het
Ttn T C 2: 76,730,649 E20809G probably damaging Het
Tubb2a A T 13: 34,075,468 V113E possibly damaging Het
Ube2d1 A T 10: 71,259,869 probably benign Het
Usp48 T C 4: 137,616,412 V452A probably benign Het
Vldlr T A 19: 27,239,664 I39N probably damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Zyg11b C T 4: 108,237,380 W669* probably null Het
Other mutations in Stard3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Stard3 APN 11 98377459 missense probably damaging 0.99
IGL00498:Stard3 APN 11 98376530 missense possibly damaging 0.90
IGL01652:Stard3 APN 11 98378733 splice site probably benign
IGL02553:Stard3 APN 11 98376563 missense possibly damaging 0.55
IGL03160:Stard3 APN 11 98378911 missense probably damaging 1.00
R0508:Stard3 UTSW 11 98372314 missense probably damaging 0.99
R1619:Stard3 UTSW 11 98376609 critical splice donor site probably null
R4781:Stard3 UTSW 11 98372334 missense possibly damaging 0.91
R6117:Stard3 UTSW 11 98372262 missense probably damaging 1.00
R6406:Stard3 UTSW 11 98378769 missense probably benign 0.06
R7290:Stard3 UTSW 11 98378219 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGGGACGTAAAGACTTTGC -3'
(R):5'- GACCTTGACAATGAGGAATGCAC -3'

Sequencing Primer
(F):5'- GTTTCTGCCAAGGAAACACTG -3'
(R):5'- TGAGGAATGCACTGGACACC -3'
Posted On2018-02-01