Incidental Mutation 'R5947:Ube2l3'
ID501992
Institutional Source Beutler Lab
Gene Symbol Ube2l3
Ensembl Gene ENSMUSG00000038965
Gene Nameubiquitin-conjugating enzyme E2L 3
SynonymsUbcM4, Ubce7
MMRRC Submission 044138-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5947 (G1)
Quality Score26
Status Validated
Chromosome16
Chromosomal Location17152013-17202649 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 17201476 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090192] [ENSMUST00000115699] [ENSMUST00000115700] [ENSMUST00000231643] [ENSMUST00000232035] [ENSMUST00000232035] [ENSMUST00000232139]
Predicted Effect probably benign
Transcript: ENSMUST00000090192
SMART Domains Protein: ENSMUSP00000087658
Gene: ENSMUSG00000038965

DomainStartEndE-ValueType
UBCc 5 149 1.43e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115699
SMART Domains Protein: ENSMUSP00000111363
Gene: ENSMUSG00000038965

DomainStartEndE-ValueType
UBCc 5 149 1.43e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115700
SMART Domains Protein: ENSMUSP00000111364
Gene: ENSMUSG00000038965

DomainStartEndE-ValueType
UBCc 5 117 1.59e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179034
Predicted Effect probably benign
Transcript: ENSMUST00000231643
Predicted Effect probably null
Transcript: ENSMUST00000232035
Predicted Effect probably null
Transcript: ENSMUST00000232035
Predicted Effect probably benign
Transcript: ENSMUST00000232139
Predicted Effect probably benign
Transcript: ENSMUST00000232668
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s) and ubiquitin-protein ligases (E3s). This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is demonstrated to participate in the ubiquitination of p53, c-Fos, and the NF-kB precursor p105 in vitro. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: A portion of hypomorphic embyros die before birth while those that survive are growth retarded and do not survive past the first day of life. The embryonic and perinatal lethality are attributed to defective placental development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T C 8: 123,967,998 probably null Het
Abt1 T C 13: 23,422,055 E243G possibly damaging Het
Afap1l1 A G 18: 61,743,700 S361P probably damaging Het
Alms1 T C 6: 85,619,712 S507P probably benign Het
Atp13a3 A G 16: 30,362,700 V34A probably benign Het
Atpaf2 A T 11: 60,405,882 probably benign Het
Bbs1 A C 19: 4,892,994 L456R probably benign Het
Bri3bp G T 5: 125,452,153 G84* probably null Het
Bri3bp G C 5: 125,452,154 probably benign Het
Car10 A C 11: 93,490,613 H134P probably damaging Het
Cntrl A G 2: 35,116,679 E119G probably damaging Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Dirc2 T C 16: 35,730,306 T308A probably benign Het
Dppa4 T C 16: 48,291,108 V100A possibly damaging Het
Elmo1 G T 13: 20,290,383 E105* probably null Het
Esrp2 T G 8: 106,132,933 probably benign Het
Exoc3l4 A G 12: 111,422,401 K108R possibly damaging Het
Exph5 G A 9: 53,375,222 R1201H probably benign Het
Galnt3 A C 2: 66,084,156 probably benign Het
Gm14486 C T 2: 30,658,801 noncoding transcript Het
Gna12 T A 5: 140,760,962 I243F probably damaging Het
Itga5 A T 15: 103,356,785 W232R probably damaging Het
Lekr1 A T 3: 65,773,077 noncoding transcript Het
Lrp1 C T 10: 127,589,554 probably null Het
Mast4 T C 13: 102,735,640 M2215V probably benign Het
Mfap5 T C 6: 122,525,986 Y52H probably damaging Het
Mrps31 A G 8: 22,414,975 K127E possibly damaging Het
Mto1 C T 9: 78,461,029 T485M probably damaging Het
Mybbp1a G A 11: 72,442,431 C107Y probably damaging Het
Nedd4 G A 9: 72,730,850 probably benign Het
Nek2 A G 1: 191,829,485 E360G probably benign Het
Notch1 T A 2: 26,462,528 probably benign Het
Nubp1 T C 16: 10,420,186 probably benign Het
Pcdhb1 G A 18: 37,266,673 R559H possibly damaging Het
Pdcd11 G A 19: 47,129,263 V1684I probably benign Het
Pggt1b G T 18: 46,248,940 N258K probably benign Het
Pou6f1 C T 15: 100,586,120 V166M possibly damaging Het
Pprc1 A G 19: 46,063,672 D546G possibly damaging Het
Psapl1 T C 5: 36,204,307 V81A probably benign Het
Rin2 T A 2: 145,844,943 probably benign Het
Rpf1 A G 3: 146,506,544 F347S probably damaging Het
Rrp12 A T 19: 41,870,808 probably null Het
Ryr1 A T 7: 29,071,924 L2557Q probably null Het
Slc1a7 T C 4: 108,010,300 probably benign Het
Slc35e2 T A 4: 155,611,714 M186K possibly damaging Het
Snx6 G T 12: 54,770,764 S116* probably null Het
Sptan1 T C 2: 29,994,367 probably null Het
Sucla2 T A 14: 73,592,669 M382K probably damaging Het
Susd5 T C 9: 114,057,591 L16P possibly damaging Het
Tmem260 G A 14: 48,486,801 A369T possibly damaging Het
Tmprss6 A G 15: 78,452,522 Y393H probably damaging Het
Tnrc6c A T 11: 117,722,519 Q501L probably damaging Het
Trim17 A G 11: 58,965,543 Y142C probably damaging Het
Trim65 T C 11: 116,128,282 R144G probably damaging Het
Trpm1 A G 7: 64,223,799 T601A probably benign Het
Ttn A T 2: 76,734,344 V28483E probably damaging Het
Yme1l1 T C 2: 23,195,306 probably benign Het
Zfat A G 15: 68,179,957 S663P probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Ube2l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4445001:Ube2l3 UTSW 16 17160172 missense probably benign
R5947:Ube2l3 UTSW 16 17201472 unclassified probably benign
R6979:Ube2l3 UTSW 16 17159977 splice site probably benign
Predicted Primers PCR Primer
(F):5'- ACTGACCTAACTTTGGCCGC -3'
(R):5'- TTAACTGTCCAGGTCACTCGAG -3'

Sequencing Primer
(F):5'- AGAACTGCCCAGGCTGATC -3'
(R):5'- GGTCACTCGAGTCTACACAGGATTC -3'
Posted On2018-02-13