Incidental Mutation 'R6026:Aatk'
ID502061
Institutional Source Beutler Lab
Gene Symbol Aatk
Ensembl Gene ENSMUSG00000025375
Gene Nameapoptosis-associated tyrosine kinase
SynonymsAATYK1
MMRRC Submission 044198-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R6026 (G1)
Quality Score20.0499
Status Validated
Chromosome11
Chromosomal Location120007313-120047167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120012364 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 345 (H345R)
Ref Sequence ENSEMBL: ENSMUSP00000099309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064307] [ENSMUST00000103019] [ENSMUST00000103020]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064307
AA Change: H402R

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000067181
Gene: ENSMUSG00000025375
AA Change: H402R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 30 49 N/A INTRINSIC
Pfam:Pkinase_Tyr 135 405 3.9e-63 PFAM
Pfam:Pkinase 136 404 2.6e-33 PFAM
low complexity region 425 457 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
low complexity region 615 624 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 684 695 N/A INTRINSIC
low complexity region 808 819 N/A INTRINSIC
low complexity region 913 927 N/A INTRINSIC
low complexity region 934 943 N/A INTRINSIC
low complexity region 985 1004 N/A INTRINSIC
low complexity region 1063 1082 N/A INTRINSIC
low complexity region 1085 1096 N/A INTRINSIC
low complexity region 1160 1174 N/A INTRINSIC
low complexity region 1179 1204 N/A INTRINSIC
low complexity region 1319 1333 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083666
Predicted Effect possibly damaging
Transcript: ENSMUST00000103019
AA Change: H345R

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099308
Gene: ENSMUSG00000025375
AA Change: H345R

DomainStartEndE-ValueType
Pfam:Pkinase 78 347 3e-36 PFAM
Pfam:Pkinase_Tyr 78 348 1.9e-62 PFAM
low complexity region 368 400 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
low complexity region 590 609 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 751 762 N/A INTRINSIC
low complexity region 856 870 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
low complexity region 928 947 N/A INTRINSIC
low complexity region 1006 1025 N/A INTRINSIC
low complexity region 1028 1039 N/A INTRINSIC
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1122 1147 N/A INTRINSIC
low complexity region 1262 1276 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103020
AA Change: H345R

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099309
Gene: ENSMUSG00000025375
AA Change: H345R

DomainStartEndE-ValueType
Pfam:Pkinase 78 347 3e-36 PFAM
Pfam:Pkinase_Tyr 78 348 1.9e-62 PFAM
low complexity region 368 400 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
low complexity region 590 609 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 751 762 N/A INTRINSIC
low complexity region 856 870 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
low complexity region 928 947 N/A INTRINSIC
low complexity region 1006 1025 N/A INTRINSIC
low complexity region 1028 1039 N/A INTRINSIC
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1122 1147 N/A INTRINSIC
low complexity region 1262 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198674
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a tyrosine kinase domain at the N-terminus and a proline-rich domain at the C-terminus. This gene is induced during apoptosis, and expression of this gene may be a necessary pre-requisite for the induction of growth arrest and/or apoptosis of myeloid precursor cells. This gene has been shown to produce neuronal differentiation in a neuroblastoma cell line. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased brain size, longer axons and fewer neurites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,755 D187G probably benign Het
4933421I07Rik A T 7: 42,446,284 M180K probably benign Het
Abcc8 T C 7: 46,167,000 T239A probably benign Het
Abcf3 A G 16: 20,550,570 E234G probably damaging Het
Actrt2 T C 4: 154,666,590 D363G possibly damaging Het
Adam1a A T 5: 121,519,362 C623S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Barhl2 T A 5: 106,455,608 K228N probably benign Het
Blvrb A G 7: 27,462,690 H153R probably damaging Het
Capn9 A G 8: 124,605,862 D480G probably damaging Het
Cct3 T C 3: 88,311,722 I182T possibly damaging Het
Clasp2 A G 9: 113,911,578 N1208D probably benign Het
Col26a1 A G 5: 136,847,500 C89R probably damaging Het
Cops4 T A 5: 100,542,328 probably benign Het
Cpox T A 16: 58,670,935 W170R probably damaging Het
Ddx27 A G 2: 167,033,640 K656E probably benign Het
Eif4e T C 3: 138,550,900 I66T probably damaging Het
Ercc3 T C 18: 32,245,921 probably null Het
Esp38 G A 17: 39,955,141 C47Y probably damaging Het
Fancd2 T C 6: 113,551,770 V380A possibly damaging Het
Fbxw7 T A 3: 84,952,641 probably null Het
Fryl T G 5: 73,099,997 R736S probably benign Het
Gad2 G A 2: 22,623,736 V62M probably benign Het
Gigyf2 A G 1: 87,440,732 T1045A probably damaging Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm19410 G A 8: 35,812,426 S1815N probably benign Het
Gm28051 A T 12: 102,720,185 L72Q unknown Het
Gm44511 T C 6: 128,820,277 T83A possibly damaging Het
Grk2 C T 19: 4,290,783 V246I probably damaging Het
Grm7 C T 6: 111,501,539 Q62* probably null Het
Gsdmc3 T A 15: 63,866,751 E154V probably damaging Het
Gstz1 A C 12: 87,160,174 Q114P probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hhip A T 8: 79,972,440 C666S probably damaging Het
Hif1a A C 12: 73,932,281 H193P probably damaging Het
Hyal2 A G 9: 107,572,199 T385A probably benign Het
Ihh T C 1: 74,946,727 T200A probably benign Het
Iqgap3 T A 3: 88,090,171 V218E probably damaging Het
Lct A G 1: 128,300,018 I1246T probably benign Het
Lmo7 T C 14: 101,880,990 V217A probably benign Het
Lrp1 C T 10: 127,573,403 D1616N probably damaging Het
Lrrfip2 A T 9: 111,214,171 T165S probably damaging Het
Morc2b A G 17: 33,137,983 Y272H possibly damaging Het
Muc16 A G 9: 18,659,858 M455T unknown Het
Ncapg2 A T 12: 116,443,021 D939V possibly damaging Het
Ncbp3 T C 11: 73,067,722 V236A probably benign Het
Obscn T A 11: 59,067,090 T3595S probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr410 T A 11: 74,335,088 I48F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pdzrn3 A C 6: 101,362,144 C269G probably benign Het
Pear1 T A 3: 87,756,913 N278Y probably damaging Het
Phb C T 11: 95,671,419 R41* probably null Het
Pikfyve T C 1: 65,272,697 V2031A probably damaging Het
Plxna2 A G 1: 194,799,814 I1465V probably damaging Het
Ppp6r2 A G 15: 89,282,910 N776S probably benign Het
Prkce A T 17: 86,493,230 E358V probably benign Het
Prl5a1 A T 13: 28,151,264 I219F probably benign Het
Prss3 T C 6: 41,377,554 probably null Het
Ptprc A T 1: 138,071,249 M858K probably damaging Het
Retreg3 T C 11: 101,106,400 T85A probably damaging Het
Rfc2 T A 5: 134,595,331 C265S probably damaging Het
Smarcd1 G T 15: 99,705,738 V256L probably damaging Het
Stat5a T C 11: 100,880,316 F574L probably damaging Het
Tcirg1 T C 19: 3,897,487 H624R probably benign Het
Tcstv1 C A 13: 119,894,451 probably benign Het
Tenm2 C T 11: 36,072,729 probably null Het
Tomm40 A G 7: 19,710,964 V164A probably benign Het
Txnl4a T C 18: 80,207,267 V26A probably damaging Het
Ugt2a3 A T 5: 87,336,477 F229L probably benign Het
Utp20 T C 10: 88,768,679 T1785A probably benign Het
Vmn1r22 T A 6: 57,900,405 I196L probably benign Het
Zfp652 T G 11: 95,749,962 C238G possibly damaging Het
Other mutations in Aatk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Aatk APN 11 120010186 missense probably benign 0.02
IGL00953:Aatk APN 11 120011221 missense probably benign 0.00
IGL01019:Aatk APN 11 120012275 missense probably benign
IGL01758:Aatk APN 11 120010819 missense possibly damaging 0.86
IGL02377:Aatk APN 11 120046863 utr 5 prime probably benign
IGL02902:Aatk APN 11 120011777 missense probably benign 0.00
IGL03067:Aatk APN 11 120010083 missense probably benign 0.00
IGL03116:Aatk APN 11 120016751 missense probably benign 0.14
IGL03279:Aatk APN 11 120013678 missense probably damaging 1.00
IGL03405:Aatk APN 11 120016403 missense probably benign 0.02
PIT4366001:Aatk UTSW 11 120010960 missense possibly damaging 0.55
PIT4802001:Aatk UTSW 11 120011346 missense probably benign
R0101:Aatk UTSW 11 120010913 missense probably benign 0.19
R0497:Aatk UTSW 11 120018780 missense probably damaging 0.99
R0535:Aatk UTSW 11 120010193 missense probably benign 0.00
R0638:Aatk UTSW 11 120009922 missense probably damaging 1.00
R0939:Aatk UTSW 11 120012143 missense probably damaging 0.99
R1475:Aatk UTSW 11 120010888 missense probably damaging 0.96
R1840:Aatk UTSW 11 120013732 missense probably damaging 1.00
R1865:Aatk UTSW 11 120010222 missense probably benign 0.00
R1982:Aatk UTSW 11 120013514 missense probably damaging 1.00
R2027:Aatk UTSW 11 120009317 missense probably damaging 1.00
R2115:Aatk UTSW 11 120009736 missense probably benign
R2220:Aatk UTSW 11 120012177 missense probably damaging 1.00
R2264:Aatk UTSW 11 120010274 missense probably damaging 1.00
R2504:Aatk UTSW 11 120018855 missense probably benign 0.00
R3872:Aatk UTSW 11 120010219 missense possibly damaging 0.71
R4551:Aatk UTSW 11 120011569 missense probably benign 0.03
R4657:Aatk UTSW 11 120013478 missense possibly damaging 0.69
R4744:Aatk UTSW 11 120016122 missense possibly damaging 0.64
R4924:Aatk UTSW 11 120011525 missense probably damaging 1.00
R5063:Aatk UTSW 11 120010489 missense probably benign 0.07
R5223:Aatk UTSW 11 120013452 missense possibly damaging 0.95
R5243:Aatk UTSW 11 120016768 missense probably damaging 1.00
R5376:Aatk UTSW 11 120012034 missense probably damaging 0.98
R5442:Aatk UTSW 11 120018768 missense probably benign 0.02
R5550:Aatk UTSW 11 120009303 missense probably benign 0.42
R5678:Aatk UTSW 11 120010154 missense probably benign 0.00
R5932:Aatk UTSW 11 120021533 missense probably damaging 1.00
R6129:Aatk UTSW 11 120021533 missense probably damaging 1.00
R6409:Aatk UTSW 11 120011732 missense probably benign 0.01
R6477:Aatk UTSW 11 120018870 missense probably benign 0.00
R6478:Aatk UTSW 11 120010991 missense probably benign 0.00
R6749:Aatk UTSW 11 120010774 missense possibly damaging 0.58
R6753:Aatk UTSW 11 120010151 missense probably benign
R6787:Aatk UTSW 11 120010682 missense probably damaging 1.00
R6852:Aatk UTSW 11 120010468 missense probably benign 0.10
R7114:Aatk UTSW 11 120009619 missense probably benign
X0064:Aatk UTSW 11 120011176 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AGCACGTCATCACTGTCCAC -3'
(R):5'- TTCCCAGGGTACTCTGAGCATG -3'

Sequencing Primer
(F):5'- GTCATCACTGTCCACGTGAAAG -3'
(R):5'- TACTCTGAGCATGGGGGAAC -3'
Posted On2018-02-26