Incidental Mutation 'R6185:Igf2'
ID502109
Institutional Source Beutler Lab
Gene Symbol Igf2
Ensembl Gene ENSMUSG00000048583
Gene Nameinsulin-like growth factor 2
SynonymsM6pr, Mpr, Igf-2, Igf-II, Peg2
MMRRC Submission 044325-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R6185 (G1)
Quality Score171.009
Status Not validated
Chromosome7
Chromosomal Location142650766-142666816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 142658381 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 4 (S4C)
Ref Sequence ENSEMBL: ENSMUSP00000114076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000033] [ENSMUST00000097936] [ENSMUST00000105935] [ENSMUST00000105936] [ENSMUST00000121128] [ENSMUST00000145896] [ENSMUST00000178921] [ENSMUST00000228850]
Predicted Effect probably benign
Transcript: ENSMUST00000000033
SMART Domains Protein: ENSMUSP00000000033
Gene: ENSMUSG00000048583

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Pfam:IGF2_C 112 166 3.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093631
Predicted Effect probably benign
Transcript: ENSMUST00000097936
SMART Domains Protein: ENSMUSP00000095549
Gene: ENSMUSG00000048583

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Pfam:IGF2_C 112 166 3.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105935
SMART Domains Protein: ENSMUSP00000101555
Gene: ENSMUSG00000048583

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Pfam:IGF2_C 112 166 3.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105936
SMART Domains Protein: ENSMUSP00000101556
Gene: ENSMUSG00000048583

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Pfam:IGF2_C 112 166 3.2e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121128
AA Change: S4C

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114076
Gene: ENSMUSG00000048583
AA Change: S4C

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
IlGF 41 95 2.09e-22 SMART
Pfam:IGF2_C 123 177 6.9e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143666
Predicted Effect probably benign
Transcript: ENSMUST00000145896
SMART Domains Protein: ENSMUSP00000122653
Gene: ENSMUSG00000048583

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178921
SMART Domains Protein: ENSMUSP00000136786
Gene: ENSMUSG00000048583

DomainStartEndE-ValueType
IlGF 67 121 2.09e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228850
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: This gene encodes a member of the insulin-like growth factor (IGF) family of proteins that promote growth and development during fetal and postnatal life. It is an imprinted gene that is expressed only from the paternal allele. The encoded protein undergoes proteolytic processing to generate a mature peptide. The transgenic overexpression of this gene in mice results in prenatal overgrowth, polyhydramnios, fetal and neonatal lethality, disproportionate organ overgrowth including tongue enlargement, and skeletal abnormalities. Mice lacking the encoded protein exhibit growth deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mutations that are paternally transmitted result in growth deficiency. Heterozygous mice inheriting a mutant allele from their mother appear to be phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,078,089 H894Q probably benign Het
Abca4 A T 3: 122,126,140 I1024F probably damaging Het
Acadl A G 1: 66,838,363 V343A possibly damaging Het
Akr1e1 T A 13: 4,601,253 I123L probably benign Het
Angptl2 T C 2: 33,229,014 S267P probably benign Het
Ap2a1 T G 7: 44,916,170 K91T probably damaging Het
Bend7 A T 2: 4,788,522 Q379L probably damaging Het
Bicdl1 C T 5: 115,670,153 probably null Het
Cachd1 C A 4: 100,981,031 Y830* probably null Het
Ccdc158 T A 5: 92,666,854 I38F possibly damaging Het
Cep97 T A 16: 55,915,092 M448L probably benign Het
Chd9 A G 8: 91,049,137 D2572G probably damaging Het
Clcnkb C T 4: 141,414,514 V54M probably benign Het
Cln8 A G 8: 14,896,544 D186G probably benign Het
Crxos C T 7: 15,902,880 S22L possibly damaging Het
Cx3cr1 A T 9: 120,051,378 H319Q probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Dmrta1 A G 4: 89,691,768 R322G probably damaging Het
Dpf1 A G 7: 29,311,271 E103G possibly damaging Het
Dsg1b T G 18: 20,399,486 V529G probably benign Het
Dst G A 1: 34,173,080 V1361I probably damaging Het
Epha4 T C 1: 77,507,106 I89V probably damaging Het
Etfdh G T 3: 79,605,807 H370N probably benign Het
Fam186a A G 15: 99,947,649 I238T unknown Het
Fbxl5 T A 5: 43,821,552 S19C probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fryl A G 5: 73,112,788 V367A probably benign Het
Gm19410 T A 8: 35,807,510 L1495H possibly damaging Het
Gm19965 A G 1: 116,821,273 E228G possibly damaging Het
Gpr89 C A 3: 96,890,833 C169F probably damaging Het
Hmcn1 A T 1: 150,615,438 probably null Het
Hsph1 A T 5: 149,617,695 C753S probably damaging Het
Kansl3 A T 1: 36,346,018 S486T probably damaging Het
Khdrbs1 G C 4: 129,742,275 probably benign Het
Lnx1 A T 5: 74,685,608 C60* probably null Het
Lrpprc T C 17: 84,767,024 D485G probably benign Het
Ly6i A T 15: 74,980,030 S97T possibly damaging Het
Me2 G A 18: 73,791,128 Q338* probably null Het
Med16 A T 10: 79,896,363 L790Q probably damaging Het
Muc16 G T 9: 18,654,473 T2250K unknown Het
Myo10 T G 15: 25,726,510 F273C probably damaging Het
Neil3 T A 8: 53,599,147 H472L probably benign Het
Nrxn1 T A 17: 90,037,136 S57C probably damaging Het
Nup188 A T 2: 30,341,710 T1439S probably damaging Het
Olfr1128 A G 2: 87,544,743 M267T possibly damaging Het
Olfr1512 T C 14: 52,372,562 T164A possibly damaging Het
Olfr978 T C 9: 39,994,124 F105L probably benign Het
Otud7a T A 7: 63,758,385 L812Q probably damaging Het
Paip2b C T 6: 83,809,970 A95T probably benign Het
Pax4 C T 6: 28,446,348 V49I probably damaging Het
Plek C T 11: 16,981,829 A341T probably damaging Het
Prkag1 G A 15: 98,825,714 P10L probably benign Het
R3hdm1 A C 1: 128,151,861 D15A possibly damaging Het
Rad54b A T 4: 11,593,804 D144V possibly damaging Het
Rmi2 C T 16: 10,886,209 T138I probably benign Het
Sbf1 A G 15: 89,305,611 L379P probably damaging Het
Sec14l3 A T 11: 4,075,244 I285F probably damaging Het
Sec31b A T 19: 44,543,284 I62N possibly damaging Het
Selp A G 1: 164,126,346 N72D probably damaging Het
Sipa1l1 T A 12: 82,425,028 S1261T probably damaging Het
Sipa1l2 A T 8: 125,468,253 Y915* probably null Het
Slc22a27 A T 19: 7,926,588 D61E probably benign Het
Slc2a7 A G 4: 150,148,993 T8A probably benign Het
Slc5a2 T C 7: 128,271,177 I529T probably damaging Het
Spg20 A C 3: 55,117,219 Q78H probably damaging Het
Spocd1 T C 4: 129,956,449 I756T probably benign Het
Stc1 G A 14: 69,038,364 C202Y probably damaging Het
Stk10 A G 11: 32,577,749 T166A probably benign Het
Syt6 A T 3: 103,585,528 D32V probably damaging Het
Tanc1 T A 2: 59,791,585 probably null Het
Tanc2 T A 11: 105,913,039 N297K probably damaging Het
Telo2 A G 17: 25,102,040 S734P probably benign Het
Tfrc T A 16: 32,618,272 Y250N probably benign Het
Tmem97 C T 11: 78,543,562 W65* probably null Het
Ubr3 T C 2: 69,938,277 M476T probably damaging Het
Ubtf T C 11: 102,314,023 T117A probably damaging Het
Usp17lb T A 7: 104,841,424 M99L probably benign Het
Uvrag A C 7: 99,140,832 probably null Het
Vmn2r63 A G 7: 42,929,011 S153P probably damaging Het
Vmn2r90 A T 17: 17,733,382 T603S probably damaging Het
Vps8 C A 16: 21,470,141 L417I probably damaging Het
Other mutations in Igf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Igf2 APN 7 142654048 missense probably benign 0.09
R2012:Igf2 UTSW 7 142654399 missense probably damaging 1.00
R4024:Igf2 UTSW 7 142654307 missense probably benign 0.23
R4275:Igf2 UTSW 7 142655786 missense probably benign 0.00
R5247:Igf2 UTSW 7 142653931 missense possibly damaging 0.90
R5825:Igf2 UTSW 7 142653855 missense probably damaging 0.97
R7286:Igf2 UTSW 7 142655818 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CTGTGAGTTCAACTTACACACCC -3'
(R):5'- AGTACAATATCTGGCCCGCC -3'

Sequencing Primer
(F):5'- GAGTTCAACTTACACACCCCCTCC -3'
(R):5'- GCCCTAAGATACCCTAAAGAAGCAG -3'
Posted On2018-02-27