Incidental Mutation 'R6185:Nrxn1'
ID502142
Institutional Source Beutler Lab
Gene Symbol Nrxn1
Ensembl Gene ENSMUSG00000024109
Gene Nameneurexin I
Synonymsneurexin I beta, alpha-latrotoxin receptor (calcium-dependent), A230068P09Rik, neurexin I alpha, neurexin I alpha, neurexin I beta, 1700062G21Rik, 9330127H16Rik, neurexin I alpha, neurexin I beta
MMRRC Submission 044325-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6185 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location90033631-91093071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90037136 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 57 (S57C)
Ref Sequence ENSEMBL: ENSMUSP00000146701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054059] [ENSMUST00000072671] [ENSMUST00000159778] [ENSMUST00000160800] [ENSMUST00000160844] [ENSMUST00000161402] [ENSMUST00000172466] [ENSMUST00000173222] [ENSMUST00000173917] [ENSMUST00000174331] [ENSMUST00000174337] [ENSMUST00000197104] [ENSMUST00000197268]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054059
AA Change: S1481C

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057294
Gene: ENSMUSG00000024109
AA Change: S1481C

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 438 2.3e-36 SMART
LamG 492 644 2.74e-43 SMART
EGF 671 705 1.58e-3 SMART
LamG 730 869 7.27e-25 SMART
LamG 917 1053 8.46e-35 SMART
EGF 1078 1112 1.87e1 SMART
LamG 1140 1297 7.74e-20 SMART
low complexity region 1324 1355 N/A INTRINSIC
low complexity region 1426 1441 N/A INTRINSIC
4.1m 1444 1462 1.19e-6 SMART
low complexity region 1481 1493 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000072671
AA Change: S1478C

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072458
Gene: ENSMUSG00000024109
AA Change: S1478C

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 438 2.3e-36 SMART
LamG 492 644 2.74e-43 SMART
EGF 671 705 1.58e-3 SMART
LamG 730 869 7.27e-25 SMART
LamG 917 1053 8.46e-35 SMART
EGF 1078 1112 1.87e1 SMART
LamG 1140 1297 7.74e-20 SMART
low complexity region 1324 1355 N/A INTRINSIC
low complexity region 1423 1438 N/A INTRINSIC
4.1m 1441 1459 1.19e-6 SMART
low complexity region 1478 1490 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159778
AA Change: S420C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125561
Gene: ENSMUSG00000024109
AA Change: S420C

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 284 418 2.3e-36 SMART
LamG 472 624 2.74e-43 SMART
EGF 651 685 1.58e-3 SMART
LamG 710 849 7.27e-25 SMART
LamG 897 1033 8.46e-35 SMART
EGF 1058 1092 1.87e1 SMART
LamG 1120 1277 7.74e-20 SMART
low complexity region 1304 1335 N/A INTRINSIC
low complexity region 1403 1418 N/A INTRINSIC
4.1m 1421 1439 1.19e-6 SMART
low complexity region 1458 1470 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160800
AA Change: S1477C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124561
Gene: ENSMUSG00000024109
AA Change: S1477C

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 300 434 2.3e-36 SMART
LamG 488 640 2.74e-43 SMART
EGF 667 701 1.58e-3 SMART
LamG 726 865 7.27e-25 SMART
LamG 913 1049 8.46e-35 SMART
EGF 1074 1108 1.87e1 SMART
LamG 1136 1293 7.74e-20 SMART
low complexity region 1320 1351 N/A INTRINSIC
low complexity region 1422 1437 N/A INTRINSIC
4.1m 1440 1458 1.19e-6 SMART
low complexity region 1477 1489 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160844
AA Change: S1489C

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125407
Gene: ENSMUSG00000024109
AA Change: S1489C

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 446 1.24e-32 SMART
LamG 500 652 2.74e-43 SMART
EGF 679 713 1.58e-3 SMART
LamG 738 877 7.27e-25 SMART
LamG 925 1061 8.46e-35 SMART
EGF 1086 1120 1.87e1 SMART
LamG 1148 1305 7.74e-20 SMART
low complexity region 1332 1363 N/A INTRINSIC
low complexity region 1434 1449 N/A INTRINSIC
4.1m 1452 1470 1.19e-6 SMART
low complexity region 1489 1501 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161402
AA Change: S1496C

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124116
Gene: ENSMUSG00000024109
AA Change: S1496C

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 453 3.46e-31 SMART
LamG 507 659 2.74e-43 SMART
EGF 686 720 1.58e-3 SMART
LamG 745 884 7.27e-25 SMART
LamG 932 1068 8.46e-35 SMART
EGF 1093 1127 1.87e1 SMART
LamG 1155 1312 7.74e-20 SMART
low complexity region 1339 1370 N/A INTRINSIC
low complexity region 1441 1456 N/A INTRINSIC
4.1m 1459 1477 1.19e-6 SMART
low complexity region 1496 1508 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172466
AA Change: S447C

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134402
Gene: ENSMUSG00000024109
AA Change: S447C

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
LamG 109 266 7.74e-20 SMART
low complexity region 293 324 N/A INTRINSIC
low complexity region 395 410 N/A INTRINSIC
4.1m 413 431 1.19e-6 SMART
low complexity region 450 462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173222
AA Change: S57C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000173917
AA Change: S124C

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133389
Gene: ENSMUSG00000024109
AA Change: S124C

DomainStartEndE-ValueType
low complexity region 66 81 N/A INTRINSIC
4.1m 84 102 1.19e-6 SMART
low complexity region 121 133 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174331
AA Change: S1459C

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133491
Gene: ENSMUSG00000024109
AA Change: S1459C

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 446 1.24e-32 SMART
LamG 500 652 2.74e-43 SMART
EGF 679 713 1.58e-3 SMART
LamG 738 877 7.27e-25 SMART
LamG 925 1061 8.46e-35 SMART
EGF 1086 1120 1.87e1 SMART
LamG 1148 1275 3.29e-23 SMART
low complexity region 1302 1333 N/A INTRINSIC
low complexity region 1404 1419 N/A INTRINSIC
4.1m 1422 1440 1.19e-6 SMART
low complexity region 1459 1471 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174337
AA Change: S450C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133724
Gene: ENSMUSG00000024109
AA Change: S450C

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
LamG 109 236 3.29e-23 SMART
low complexity region 263 294 N/A INTRINSIC
low complexity region 365 380 N/A INTRINSIC
4.1m 383 401 1.19e-6 SMART
low complexity region 420 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197104
SMART Domains Protein: ENSMUSP00000142621
Gene: ENSMUSG00000024109

DomainStartEndE-ValueType
Pfam:Laminin_G_2 1 69 3.2e-12 PFAM
low complexity region 96 127 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197268
AA Change: S121C

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142815
Gene: ENSMUSG00000024109
AA Change: S121C

DomainStartEndE-ValueType
low complexity region 66 81 N/A INTRINSIC
4.1m 84 102 1.19e-6 SMART
low complexity region 121 133 N/A INTRINSIC
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: This gene encodes a single-pass type I membrane protein that belongs to the neurexin family. Neurexins are synaptic transmembrane receptors that bind endogenous ligands that include neuroligins, dystroglycan, and neurexophilins. Neurexin complexes are required for efficient neurotransmission and are involved in synaptogenesis. In vertebrates, alternate promoter usage results in multiple isoform classes, of which the alpha and beta classes are the best characterized. In humans, allelic variants in this gene are associated with Pitt-Hopkins-like syndrome-2, while deletions have been associated with autism and schizophrenia. Mouse knockouts display decreased spontaneous and evoked vesicle release resulting in impaired synaptic transmission. In addition, knockout mice show altered social approach, reduced social investigation, reduced locomotor activity, and in males, increased aggression. Alternative splicing and promoter usage result in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced Ca(2+)-dependent binding of alpha-latrotoxin to brain membranes. Isolated synaptosomes display only a small reduction in alpha-latrotoxin -triggered glutamate release in the absence of Ca(2+) but show a major decrease in the presence of Ca(2+). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,078,089 H894Q probably benign Het
Abca4 A T 3: 122,126,140 I1024F probably damaging Het
Acadl A G 1: 66,838,363 V343A possibly damaging Het
Akr1e1 T A 13: 4,601,253 I123L probably benign Het
Angptl2 T C 2: 33,229,014 S267P probably benign Het
Ap2a1 T G 7: 44,916,170 K91T probably damaging Het
Bend7 A T 2: 4,788,522 Q379L probably damaging Het
Bicdl1 C T 5: 115,670,153 probably null Het
Cachd1 C A 4: 100,981,031 Y830* probably null Het
Ccdc158 T A 5: 92,666,854 I38F possibly damaging Het
Cep97 T A 16: 55,915,092 M448L probably benign Het
Chd9 A G 8: 91,049,137 D2572G probably damaging Het
Clcnkb C T 4: 141,414,514 V54M probably benign Het
Cln8 A G 8: 14,896,544 D186G probably benign Het
Crxos C T 7: 15,902,880 S22L possibly damaging Het
Cx3cr1 A T 9: 120,051,378 H319Q probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Dmrta1 A G 4: 89,691,768 R322G probably damaging Het
Dpf1 A G 7: 29,311,271 E103G possibly damaging Het
Dsg1b T G 18: 20,399,486 V529G probably benign Het
Dst G A 1: 34,173,080 V1361I probably damaging Het
Epha4 T C 1: 77,507,106 I89V probably damaging Het
Etfdh G T 3: 79,605,807 H370N probably benign Het
Fam186a A G 15: 99,947,649 I238T unknown Het
Fbxl5 T A 5: 43,821,552 S19C probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fryl A G 5: 73,112,788 V367A probably benign Het
Gm19410 T A 8: 35,807,510 L1495H possibly damaging Het
Gm19965 A G 1: 116,821,273 E228G possibly damaging Het
Gpr89 C A 3: 96,890,833 C169F probably damaging Het
Hmcn1 A T 1: 150,615,438 probably null Het
Hsph1 A T 5: 149,617,695 C753S probably damaging Het
Igf2 T A 7: 142,658,381 S4C possibly damaging Het
Kansl3 A T 1: 36,346,018 S486T probably damaging Het
Khdrbs1 G C 4: 129,742,275 probably benign Het
Lnx1 A T 5: 74,685,608 C60* probably null Het
Lrpprc T C 17: 84,767,024 D485G probably benign Het
Ly6i A T 15: 74,980,030 S97T possibly damaging Het
Me2 G A 18: 73,791,128 Q338* probably null Het
Med16 A T 10: 79,896,363 L790Q probably damaging Het
Muc16 G T 9: 18,654,473 T2250K unknown Het
Myo10 T G 15: 25,726,510 F273C probably damaging Het
Neil3 T A 8: 53,599,147 H472L probably benign Het
Nup188 A T 2: 30,341,710 T1439S probably damaging Het
Olfr1128 A G 2: 87,544,743 M267T possibly damaging Het
Olfr1512 T C 14: 52,372,562 T164A possibly damaging Het
Olfr978 T C 9: 39,994,124 F105L probably benign Het
Otud7a T A 7: 63,758,385 L812Q probably damaging Het
Paip2b C T 6: 83,809,970 A95T probably benign Het
Pax4 C T 6: 28,446,348 V49I probably damaging Het
Plek C T 11: 16,981,829 A341T probably damaging Het
Prkag1 G A 15: 98,825,714 P10L probably benign Het
R3hdm1 A C 1: 128,151,861 D15A possibly damaging Het
Rad54b A T 4: 11,593,804 D144V possibly damaging Het
Rmi2 C T 16: 10,886,209 T138I probably benign Het
Sbf1 A G 15: 89,305,611 L379P probably damaging Het
Sec14l3 A T 11: 4,075,244 I285F probably damaging Het
Sec31b A T 19: 44,543,284 I62N possibly damaging Het
Selp A G 1: 164,126,346 N72D probably damaging Het
Sipa1l1 T A 12: 82,425,028 S1261T probably damaging Het
Sipa1l2 A T 8: 125,468,253 Y915* probably null Het
Slc22a27 A T 19: 7,926,588 D61E probably benign Het
Slc2a7 A G 4: 150,148,993 T8A probably benign Het
Slc5a2 T C 7: 128,271,177 I529T probably damaging Het
Spg20 A C 3: 55,117,219 Q78H probably damaging Het
Spocd1 T C 4: 129,956,449 I756T probably benign Het
Stc1 G A 14: 69,038,364 C202Y probably damaging Het
Stk10 A G 11: 32,577,749 T166A probably benign Het
Syt6 A T 3: 103,585,528 D32V probably damaging Het
Tanc1 T A 2: 59,791,585 probably null Het
Tanc2 T A 11: 105,913,039 N297K probably damaging Het
Telo2 A G 17: 25,102,040 S734P probably benign Het
Tfrc T A 16: 32,618,272 Y250N probably benign Het
Tmem97 C T 11: 78,543,562 W65* probably null Het
Ubr3 T C 2: 69,938,277 M476T probably damaging Het
Ubtf T C 11: 102,314,023 T117A probably damaging Het
Usp17lb T A 7: 104,841,424 M99L probably benign Het
Uvrag A C 7: 99,140,832 probably null Het
Vmn2r63 A G 7: 42,929,011 S153P probably damaging Het
Vmn2r90 A T 17: 17,733,382 T603S probably damaging Het
Vps8 C A 16: 21,470,141 L417I probably damaging Het
Other mutations in Nrxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Nrxn1 APN 17 90059474 critical splice donor site probably null
IGL01644:Nrxn1 APN 17 90620873 missense possibly damaging 0.94
IGL01820:Nrxn1 APN 17 90643103 missense probably damaging 0.98
IGL01902:Nrxn1 APN 17 91088491 unclassified probably null
IGL02079:Nrxn1 APN 17 90643083 missense probably damaging 0.99
IGL02089:Nrxn1 APN 17 91088401 missense probably benign 0.01
IGL02133:Nrxn1 APN 17 90643243 missense probably damaging 1.00
IGL02179:Nrxn1 APN 17 90630083 missense probably damaging 0.99
IGL02199:Nrxn1 APN 17 90037258 missense probably damaging 1.00
IGL02262:Nrxn1 APN 17 90704208 missense probably damaging 1.00
IGL02941:Nrxn1 APN 17 90208383 missense probably damaging 1.00
PIT4449001:Nrxn1 UTSW 17 90597579 missense probably damaging 1.00
PIT4791001:Nrxn1 UTSW 17 90455503 intron probably benign
R0123:Nrxn1 UTSW 17 90995487 splice site probably null
R0212:Nrxn1 UTSW 17 90362758 unclassified probably benign
R0277:Nrxn1 UTSW 17 90700742 critical splice donor site probably null
R0323:Nrxn1 UTSW 17 90700742 critical splice donor site probably null
R0384:Nrxn1 UTSW 17 90208347 missense probably damaging 1.00
R0395:Nrxn1 UTSW 17 91088314 missense possibly damaging 0.90
R0606:Nrxn1 UTSW 17 90565373 missense probably damaging 1.00
R0616:Nrxn1 UTSW 17 90362857 missense probably damaging 1.00
R0624:Nrxn1 UTSW 17 91088689 missense unknown
R0633:Nrxn1 UTSW 17 90704181 missense probably damaging 1.00
R0927:Nrxn1 UTSW 17 90037330 missense probably damaging 1.00
R1035:Nrxn1 UTSW 17 90163874 missense probably damaging 0.96
R1221:Nrxn1 UTSW 17 90643294 missense probably damaging 0.97
R1403:Nrxn1 UTSW 17 90643053 missense probably benign 0.11
R1403:Nrxn1 UTSW 17 90643053 missense probably benign 0.11
R1691:Nrxn1 UTSW 17 90162289 missense probably damaging 0.98
R1703:Nrxn1 UTSW 17 90208417 missense probably damaging 1.00
R1709:Nrxn1 UTSW 17 90037187 missense probably damaging 1.00
R1721:Nrxn1 UTSW 17 90162404 missense probably damaging 1.00
R1792:Nrxn1 UTSW 17 90588824 missense probably damaging 0.96
R1980:Nrxn1 UTSW 17 91088318 missense probably benign 0.01
R2116:Nrxn1 UTSW 17 90704277 missense probably damaging 1.00
R2117:Nrxn1 UTSW 17 90704277 missense probably damaging 1.00
R2162:Nrxn1 UTSW 17 90162431 missense probably damaging 1.00
R3119:Nrxn1 UTSW 17 90597519 nonsense probably null
R3409:Nrxn1 UTSW 17 90208367 missense probably damaging 1.00
R3683:Nrxn1 UTSW 17 90623452 missense probably damaging 1.00
R3885:Nrxn1 UTSW 17 90623471 missense probably damaging 1.00
R3939:Nrxn1 UTSW 17 90208421 missense probably damaging 1.00
R4475:Nrxn1 UTSW 17 90701982 missense probably damaging 0.98
R4640:Nrxn1 UTSW 17 90560768 missense probably damaging 1.00
R4678:Nrxn1 UTSW 17 90623422 missense probably damaging 1.00
R4690:Nrxn1 UTSW 17 90037081 missense probably damaging 1.00
R4790:Nrxn1 UTSW 17 90455049 missense possibly damaging 0.86
R4877:Nrxn1 UTSW 17 91088177 missense probably benign 0.33
R4989:Nrxn1 UTSW 17 90620846 intron probably benign
R5204:Nrxn1 UTSW 17 90162364 missense probably damaging 1.00
R5205:Nrxn1 UTSW 17 90163874 missense probably damaging 0.96
R5239:Nrxn1 UTSW 17 90704109 missense probably damaging 1.00
R5250:Nrxn1 UTSW 17 90535441 intron probably benign
R5473:Nrxn1 UTSW 17 90590092 missense probably damaging 1.00
R5629:Nrxn1 UTSW 17 90590032 missense possibly damaging 0.75
R5743:Nrxn1 UTSW 17 90643224 missense probably damaging 1.00
R5910:Nrxn1 UTSW 17 90704318 nonsense probably null
R5961:Nrxn1 UTSW 17 90454943 missense probably damaging 0.99
R5979:Nrxn1 UTSW 17 91088203 missense possibly damaging 0.54
R5992:Nrxn1 UTSW 17 90623507 missense probably benign 0.01
R6024:Nrxn1 UTSW 17 90590098 missense possibly damaging 0.88
R6031:Nrxn1 UTSW 17 90588790 missense probably damaging 1.00
R6031:Nrxn1 UTSW 17 90588790 missense probably damaging 1.00
R6220:Nrxn1 UTSW 17 91088476 missense probably benign 0.14
R6306:Nrxn1 UTSW 17 90565446 missense possibly damaging 0.55
R6621:Nrxn1 UTSW 17 90162182 missense probably damaging 1.00
R6669:Nrxn1 UTSW 17 90059563 missense probably damaging 0.98
R6770:Nrxn1 UTSW 17 90037179 missense probably damaging 1.00
R6798:Nrxn1 UTSW 17 90629950 missense probably damaging 1.00
R6923:Nrxn1 UTSW 17 91088233 missense probably benign 0.06
R7140:Nrxn1 UTSW 17 91088764 start gained probably benign
R7374:Nrxn1 UTSW 17 90588669 critical splice donor site probably null
X0021:Nrxn1 UTSW 17 90590212 missense probably damaging 1.00
X0063:Nrxn1 UTSW 17 90362831 missense possibly damaging 0.54
Z1088:Nrxn1 UTSW 17 90059505 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGAGTTTTCCCTCCTGATCGC -3'
(R):5'- AGGCTCTGCAGAGGTGATTC -3'

Sequencing Primer
(F):5'- GCATTCCCTGTCTTCTTTTGTATGTG -3'
(R):5'- TGATTCGGGAGTCCAGCAGTAC -3'
Posted On2018-02-27