Incidental Mutation 'R6186:Apbb1'
ID502169
Institutional Source Beutler Lab
Gene Symbol Apbb1
Ensembl Gene ENSMUSG00000037032
Gene Nameamyloid beta (A4) precursor protein-binding, family B, member 1
SynonymsFe65, Rir
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6186 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location105558483-105581653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105567726 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 250 (E250G)
Ref Sequence ENSEMBL: ENSMUSP00000140116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081165] [ENSMUST00000186814] [ENSMUST00000186868] [ENSMUST00000187051] [ENSMUST00000187057] [ENSMUST00000187683] [ENSMUST00000187721] [ENSMUST00000188001] [ENSMUST00000188368] [ENSMUST00000188440] [ENSMUST00000189072] [ENSMUST00000189265] [ENSMUST00000189378] [ENSMUST00000190369] [ENSMUST00000191011] [ENSMUST00000191601] [ENSMUST00000210079]
Predicted Effect probably damaging
Transcript: ENSMUST00000081165
AA Change: E250G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079932
Gene: ENSMUSG00000037032
AA Change: E250G

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 4.16e-38 SMART
PTB 538 667 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186814
Predicted Effect probably benign
Transcript: ENSMUST00000186868
SMART Domains Protein: ENSMUSP00000140052
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 1.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187051
SMART Domains Protein: ENSMUSP00000139755
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 1.4e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
SCOP:d1shca_ 74 120 9e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187057
AA Change: E27G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139899
Gene: ENSMUSG00000037032
AA Change: E27G

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 287 3.8e-41 SMART
PTB 313 442 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187683
SMART Domains Protein: ENSMUSP00000139426
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 2.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
Pfam:PID 111 158 5.9e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187721
AA Change: E50G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140192
Gene: ENSMUSG00000037032
AA Change: E50G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
WW 54 85 3.7e-7 SMART
low complexity region 87 99 N/A INTRINSIC
Pfam:PID 170 242 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188001
Predicted Effect probably damaging
Transcript: ENSMUST00000188368
AA Change: E27G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139788
Gene: ENSMUSG00000037032
AA Change: E27G

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 289 1.8e-40 SMART
PTB 315 444 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188440
SMART Domains Protein: ENSMUSP00000140715
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 3.4e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 223 1.4e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189072
SMART Domains Protein: ENSMUSP00000139575
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189265
SMART Domains Protein: ENSMUSP00000140137
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:PID 1 34 2.3e-6 PFAM
PTB 63 192 9.5e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189378
AA Change: E250G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140979
Gene: ENSMUSG00000037032
AA Change: E250G

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190369
SMART Domains Protein: ENSMUSP00000140486
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190961
Predicted Effect probably damaging
Transcript: ENSMUST00000191011
AA Change: E250G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140973
Gene: ENSMUSG00000037032
AA Change: E250G

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191250
Predicted Effect probably damaging
Transcript: ENSMUST00000191601
AA Change: E250G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140116
Gene: ENSMUSG00000037032
AA Change: E250G

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 3.7e-7 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 1.8e-40 SMART
PTB 538 667 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210079
Predicted Effect probably benign
Transcript: ENSMUST00000211614
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Fe65 protein family. It is an adaptor protein localized in the nucleus. It interacts with the Alzheimer's disease amyloid precursor protein (APP), transcription factor CP2/LSF/LBP1 and the low-density lipoprotein receptor-related protein. APP functions as a cytosolic anchoring site that can prevent the gene product's nuclear translocation. This encoded protein could play an important role in the pathogenesis of Alzheimer's disease. It is thought to regulate transcription. Also it is observed to block cell cycle progression by downregulating thymidylate synthase expression. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for a null allele are hypersensitive to ionizing radiation while mouse embryonic fibroblasts are hypersensitive to DNA damaging agents. Homozygotes for a second null allele display impaired performance in learning and memory tasks, with a striking deficit in reversal spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 T A 5: 94,383,976 Y240N probably benign Het
Adgb A G 10: 10,422,758 S409P probably damaging Het
Adgrg5 T C 8: 94,934,024 V93A possibly damaging Het
Akap8l C T 17: 32,333,044 V420I probably benign Het
Ankrd36 T G 11: 5,643,812 D472E possibly damaging Het
AW549877 C A 15: 3,986,369 D238Y possibly damaging Het
Cacna2d4 G A 6: 119,281,689 E579K possibly damaging Het
Capn7 G T 14: 31,370,918 G780W probably damaging Het
Celsr1 T C 15: 85,921,193 E2419G possibly damaging Het
Cep164 A T 9: 45,794,109 S363R probably damaging Het
Cfap221 T A 1: 119,934,610 I581F probably damaging Het
Cog2 C A 8: 124,546,686 T588N probably damaging Het
Cyp2a5 T C 7: 26,843,388 probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Evx1 T C 6: 52,314,218 probably null Het
Fam186a T C 15: 99,947,325 H346R unknown Het
Fam205c T C 4: 42,872,000 K125R possibly damaging Het
Fam53b T A 7: 132,715,716 D399V possibly damaging Het
Fcho2 T A 13: 98,815,083 N9I probably benign Het
Fjx1 T C 2: 102,450,807 E261G probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fkbpl T C 17: 34,646,179 F307S probably benign Het
Fn1 A G 1: 71,637,290 I594T probably damaging Het
Inpp4b T A 8: 82,046,234 V719E probably damaging Het
Ldlr C T 9: 21,723,759 probably benign Het
Macf1 A G 4: 123,484,175 V1419A probably damaging Het
Mapkap1 A G 2: 34,563,114 T340A possibly damaging Het
Mark2 A G 19: 7,283,202 V403A probably benign Het
Mast3 T C 8: 70,785,483 T521A probably damaging Het
Mkl1 T C 15: 81,016,652 K546R probably damaging Het
Myo1h C T 5: 114,319,803 T125I possibly damaging Het
Ndufa8 A G 2: 36,039,740 V118A probably benign Het
Nphs1 A G 7: 30,465,634 T551A probably damaging Het
Olfr267 T C 4: 58,784,948 Y258C probably damaging Het
Olfr726 T A 14: 50,084,525 D52V probably damaging Het
Pcm1 T C 8: 41,293,793 L1343P probably benign Het
Pdcd1 T A 1: 94,040,121 R202* probably null Het
Prkab2 A G 3: 97,663,991 probably null Het
Ptdss2 T C 7: 141,154,949 probably benign Het
Rap1b G T 10: 117,820,552 F78L probably damaging Het
Rbl2 C T 8: 91,106,730 T711I probably damaging Het
Rhobtb2 A G 14: 69,798,244 I126T probably damaging Het
Rnf123 A C 9: 108,069,958 S210A possibly damaging Het
Shank1 T A 7: 44,352,566 F1228L probably benign Het
Sumo1 C A 1: 59,644,570 V38L probably benign Het
Sycp2 C T 2: 178,383,560 S363N probably damaging Het
Tbx2 G T 11: 85,837,846 E352* probably null Het
Timm44 T C 8: 4,266,824 N270D probably damaging Het
Topaz1 A T 9: 122,748,826 Q267L probably benign Het
Trp63 T C 16: 25,876,733 probably benign Het
Ushbp1 T A 8: 71,391,003 T264S possibly damaging Het
Vav3 A G 3: 109,516,067 Y334C probably damaging Het
Wdr36 G C 18: 32,852,901 A553P probably benign Het
Zfhx2 A T 14: 55,063,160 I2378K probably damaging Het
Zfp276 T A 8: 123,255,933 Y145* probably null Het
Zfp458 T C 13: 67,257,637 E246G probably damaging Het
Zfp526 A G 7: 25,226,136 T607A probably benign Het
Other mutations in Apbb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02171:Apbb1 APN 7 105559126 splice site probably benign
athena UTSW 7 105566695 missense probably benign
R0092:Apbb1 UTSW 7 105559154 missense probably damaging 1.00
R0348:Apbb1 UTSW 7 105565303 missense probably damaging 0.98
R0633:Apbb1 UTSW 7 105558963 missense probably damaging 1.00
R0946:Apbb1 UTSW 7 105573855 missense probably benign 0.09
R1076:Apbb1 UTSW 7 105573855 missense probably benign 0.09
R1332:Apbb1 UTSW 7 105565543 missense possibly damaging 0.74
R1658:Apbb1 UTSW 7 105574084 missense probably damaging 1.00
R1739:Apbb1 UTSW 7 105574227 missense probably benign
R4230:Apbb1 UTSW 7 105567684 missense probably damaging 1.00
R4296:Apbb1 UTSW 7 105573826 missense probably benign 0.16
R4385:Apbb1 UTSW 7 105567276 missense probably benign 0.00
R4571:Apbb1 UTSW 7 105573762 missense probably damaging 1.00
R4647:Apbb1 UTSW 7 105565538 missense probably benign 0.01
R4812:Apbb1 UTSW 7 105574025 missense probably damaging 0.99
R5044:Apbb1 UTSW 7 105565682 intron probably benign
R5109:Apbb1 UTSW 7 105565035 missense probably damaging 1.00
R5479:Apbb1 UTSW 7 105565025 missense probably damaging 0.97
R5611:Apbb1 UTSW 7 105559483 missense probably damaging 1.00
R5677:Apbb1 UTSW 7 105559246 missense probably damaging 1.00
R5785:Apbb1 UTSW 7 105567715 missense probably damaging 1.00
R5850:Apbb1 UTSW 7 105567583 missense probably damaging 1.00
R5896:Apbb1 UTSW 7 105574225 missense probably damaging 1.00
R6151:Apbb1 UTSW 7 105574252 nonsense probably null
R6229:Apbb1 UTSW 7 105573730 missense probably damaging 0.98
R6229:Apbb1 UTSW 7 105573731 missense probably damaging 0.98
R6288:Apbb1 UTSW 7 105559227 missense probably damaging 1.00
R6295:Apbb1 UTSW 7 105566695 missense probably benign
R6443:Apbb1 UTSW 7 105573763 missense probably damaging 1.00
R6729:Apbb1 UTSW 7 105565381 missense probably damaging 1.00
Z1088:Apbb1 UTSW 7 105559136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGTTCTAGAAGACAGACCC -3'
(R):5'- ACTGGTGGCTCCCAATATGG -3'

Sequencing Primer
(F):5'- TTCCACCCCTGGCATGGAAC -3'
(R):5'- GCTCCCAATATGGTGACTCAAGTG -3'
Posted On2018-02-27