Incidental Mutation 'R6186:Ptdss2'
ID502171
Institutional Source Beutler Lab
Gene Symbol Ptdss2
Ensembl Gene ENSMUSG00000025495
Gene Namephosphatidylserine synthase 2
SynonymsPSS2
MMRRC Submission 044326-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6186 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location141122382-141157606 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 141154949 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026568] [ENSMUST00000172479] [ENSMUST00000172787] [ENSMUST00000209928]
Predicted Effect silent
Transcript: ENSMUST00000026568
SMART Domains Protein: ENSMUSP00000026568
Gene: ENSMUSG00000025495

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
transmembrane domain 73 90 N/A INTRINSIC
Pfam:PSS 98 378 1.8e-113 PFAM
transmembrane domain 388 410 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172479
Predicted Effect probably benign
Transcript: ENSMUST00000172787
SMART Domains Protein: ENSMUSP00000133352
Gene: ENSMUSG00000025495

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 35 52 N/A INTRINSIC
Pfam:PSS 60 191 7.3e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174706
Predicted Effect unknown
Transcript: ENSMUST00000209928
AA Change: L31S
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of phosphatidylethanolamine to phosphatidylserine, a structural membrane phospholipid that functions in cell signaling, blood coagulation, and apoptosis. The encoded enzyme also has a high affinity for docosahexaenoic acid (DHA) and can use it to make DHA-containing phosphatidylserine. [provided by RefSeq, Jul 2016]
PHENOTYPE: Disruption of this gene causes infertility in about 10% of homozygous males. The remaining males and all females were fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 T A 5: 94,383,976 Y240N probably benign Het
Adgb A G 10: 10,422,758 S409P probably damaging Het
Adgrg5 T C 8: 94,934,024 V93A possibly damaging Het
Akap8l C T 17: 32,333,044 V420I probably benign Het
Ankrd36 T G 11: 5,643,812 D472E possibly damaging Het
Apbb1 T C 7: 105,567,726 E250G probably damaging Het
AW549877 C A 15: 3,986,369 D238Y possibly damaging Het
Cacna2d4 G A 6: 119,281,689 E579K possibly damaging Het
Capn7 G T 14: 31,370,918 G780W probably damaging Het
Celsr1 T C 15: 85,921,193 E2419G possibly damaging Het
Cep164 A T 9: 45,794,109 S363R probably damaging Het
Cfap221 T A 1: 119,934,610 I581F probably damaging Het
Cog2 C A 8: 124,546,686 T588N probably damaging Het
Cyp2a5 T C 7: 26,843,388 probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Evx1 T C 6: 52,314,218 probably null Het
Fam186a T C 15: 99,947,325 H346R unknown Het
Fam205c T C 4: 42,872,000 K125R possibly damaging Het
Fam53b T A 7: 132,715,716 D399V possibly damaging Het
Fcho2 T A 13: 98,815,083 N9I probably benign Het
Fjx1 T C 2: 102,450,807 E261G probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fkbpl T C 17: 34,646,179 F307S probably benign Het
Fn1 A G 1: 71,637,290 I594T probably damaging Het
Inpp4b T A 8: 82,046,234 V719E probably damaging Het
Ldlr C T 9: 21,723,759 probably benign Het
Macf1 A G 4: 123,484,175 V1419A probably damaging Het
Mapkap1 A G 2: 34,563,114 T340A possibly damaging Het
Mark2 A G 19: 7,283,202 V403A probably benign Het
Mast3 T C 8: 70,785,483 T521A probably damaging Het
Mkl1 T C 15: 81,016,652 K546R probably damaging Het
Myo1h C T 5: 114,319,803 T125I possibly damaging Het
Ndufa8 A G 2: 36,039,740 V118A probably benign Het
Nphs1 A G 7: 30,465,634 T551A probably damaging Het
Olfr267 T C 4: 58,784,948 Y258C probably damaging Het
Olfr726 T A 14: 50,084,525 D52V probably damaging Het
Pcm1 T C 8: 41,293,793 L1343P probably benign Het
Pdcd1 T A 1: 94,040,121 R202* probably null Het
Prkab2 A G 3: 97,663,991 probably null Het
Rap1b G T 10: 117,820,552 F78L probably damaging Het
Rbl2 C T 8: 91,106,730 T711I probably damaging Het
Rhobtb2 A G 14: 69,798,244 I126T probably damaging Het
Rnf123 A C 9: 108,069,958 S210A possibly damaging Het
Shank1 T A 7: 44,352,566 F1228L probably benign Het
Sumo1 C A 1: 59,644,570 V38L probably benign Het
Sycp2 C T 2: 178,383,560 S363N probably damaging Het
Tbx2 G T 11: 85,837,846 E352* probably null Het
Timm44 T C 8: 4,266,824 N270D probably damaging Het
Topaz1 A T 9: 122,748,826 Q267L probably benign Het
Trp63 T C 16: 25,876,733 probably benign Het
Ushbp1 T A 8: 71,391,003 T264S possibly damaging Het
Vav3 A G 3: 109,516,067 Y334C probably damaging Het
Wdr36 G C 18: 32,852,901 A553P probably benign Het
Zfhx2 A T 14: 55,063,160 I2378K probably damaging Het
Zfp276 T A 8: 123,255,933 Y145* probably null Het
Zfp458 T C 13: 67,257,637 E246G probably damaging Het
Zfp526 A G 7: 25,226,136 T607A probably benign Het
Other mutations in Ptdss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Ptdss2 APN 7 141143125 missense probably benign 0.35
IGL01860:Ptdss2 APN 7 141152836 missense probably damaging 1.00
IGL01966:Ptdss2 APN 7 141135391 missense possibly damaging 0.66
IGL02606:Ptdss2 APN 7 141152998 nonsense probably null
R0105:Ptdss2 UTSW 7 141152880 missense probably damaging 1.00
R0138:Ptdss2 UTSW 7 141155319 splice site probably benign
R0503:Ptdss2 UTSW 7 141151797 unclassified probably benign
R2397:Ptdss2 UTSW 7 141147092 missense probably benign 0.02
R3120:Ptdss2 UTSW 7 141152219 missense probably damaging 1.00
R4519:Ptdss2 UTSW 7 141154578 missense probably benign 0.30
R4728:Ptdss2 UTSW 7 141154459 missense probably benign 0.30
R5158:Ptdss2 UTSW 7 141151771 missense probably benign 0.16
R6464:Ptdss2 UTSW 7 141152211 missense probably damaging 1.00
R6580:Ptdss2 UTSW 7 141153012 missense probably damaging 1.00
R7290:Ptdss2 UTSW 7 141151780 missense possibly damaging 0.58
R7307:Ptdss2 UTSW 7 141151732 missense possibly damaging 0.51
R7444:Ptdss2 UTSW 7 141153084 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAAATGCCCTTGTGCTGAAC -3'
(R):5'- TATAGGCAGGACAGGTCACC -3'

Sequencing Primer
(F):5'- CTGAACAAGCCAGGCAGCTG -3'
(R):5'- CTCACAGAGAGTACACGGGC -3'
Posted On2018-02-27