Incidental Mutation 'R6186:Celsr1'
ID502197
Institutional Source Beutler Lab
Gene Symbol Celsr1
Ensembl Gene ENSMUSG00000016028
Gene Namecadherin, EGF LAG seven-pass G-type receptor 1
Synonymscrash, Crsh, Scy
MMRRC Submission 044326-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.735) question?
Stock #R6186 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location85898929-86033777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85921193 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2419 (E2419G)
Ref Sequence ENSEMBL: ENSMUSP00000016172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016172]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016172
AA Change: E2419G

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: E2419G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000226840
AA Change: E1052G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227450
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 T A 5: 94,383,976 Y240N probably benign Het
Adgb A G 10: 10,422,758 S409P probably damaging Het
Adgrg5 T C 8: 94,934,024 V93A possibly damaging Het
Akap8l C T 17: 32,333,044 V420I probably benign Het
Ankrd36 T G 11: 5,643,812 D472E possibly damaging Het
Apbb1 T C 7: 105,567,726 E250G probably damaging Het
AW549877 C A 15: 3,986,369 D238Y possibly damaging Het
Cacna2d4 G A 6: 119,281,689 E579K possibly damaging Het
Capn7 G T 14: 31,370,918 G780W probably damaging Het
Cep164 A T 9: 45,794,109 S363R probably damaging Het
Cfap221 T A 1: 119,934,610 I581F probably damaging Het
Cog2 C A 8: 124,546,686 T588N probably damaging Het
Cyp2a5 T C 7: 26,843,388 probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Evx1 T C 6: 52,314,218 probably null Het
Fam186a T C 15: 99,947,325 H346R unknown Het
Fam205c T C 4: 42,872,000 K125R possibly damaging Het
Fam53b T A 7: 132,715,716 D399V possibly damaging Het
Fcho2 T A 13: 98,815,083 N9I probably benign Het
Fjx1 T C 2: 102,450,807 E261G probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fkbpl T C 17: 34,646,179 F307S probably benign Het
Fn1 A G 1: 71,637,290 I594T probably damaging Het
Inpp4b T A 8: 82,046,234 V719E probably damaging Het
Ldlr C T 9: 21,723,759 probably benign Het
Macf1 A G 4: 123,484,175 V1419A probably damaging Het
Mapkap1 A G 2: 34,563,114 T340A possibly damaging Het
Mark2 A G 19: 7,283,202 V403A probably benign Het
Mast3 T C 8: 70,785,483 T521A probably damaging Het
Mkl1 T C 15: 81,016,652 K546R probably damaging Het
Myo1h C T 5: 114,319,803 T125I possibly damaging Het
Ndufa8 A G 2: 36,039,740 V118A probably benign Het
Nphs1 A G 7: 30,465,634 T551A probably damaging Het
Olfr267 T C 4: 58,784,948 Y258C probably damaging Het
Olfr726 T A 14: 50,084,525 D52V probably damaging Het
Pcm1 T C 8: 41,293,793 L1343P probably benign Het
Pdcd1 T A 1: 94,040,121 R202* probably null Het
Prkab2 A G 3: 97,663,991 probably null Het
Ptdss2 T C 7: 141,154,949 probably benign Het
Rap1b G T 10: 117,820,552 F78L probably damaging Het
Rbl2 C T 8: 91,106,730 T711I probably damaging Het
Rhobtb2 A G 14: 69,798,244 I126T probably damaging Het
Rnf123 A C 9: 108,069,958 S210A possibly damaging Het
Shank1 T A 7: 44,352,566 F1228L probably benign Het
Sumo1 C A 1: 59,644,570 V38L probably benign Het
Sycp2 C T 2: 178,383,560 S363N probably damaging Het
Tbx2 G T 11: 85,837,846 E352* probably null Het
Timm44 T C 8: 4,266,824 N270D probably damaging Het
Topaz1 A T 9: 122,748,826 Q267L probably benign Het
Trp63 T C 16: 25,876,733 probably benign Het
Ushbp1 T A 8: 71,391,003 T264S possibly damaging Het
Vav3 A G 3: 109,516,067 Y334C probably damaging Het
Wdr36 G C 18: 32,852,901 A553P probably benign Het
Zfhx2 A T 14: 55,063,160 I2378K probably damaging Het
Zfp276 T A 8: 123,255,933 Y145* probably null Het
Zfp458 T C 13: 67,257,637 E246G probably damaging Het
Zfp526 A G 7: 25,226,136 T607A probably benign Het
Other mutations in Celsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Celsr1 APN 15 85931345 missense probably benign 0.04
IGL00519:Celsr1 APN 15 86030836 missense probably damaging 1.00
IGL00909:Celsr1 APN 15 85922235 missense probably damaging 1.00
IGL01303:Celsr1 APN 15 86030491 missense probably damaging 0.97
IGL01726:Celsr1 APN 15 85926190 missense probably benign 0.35
IGL01910:Celsr1 APN 15 85929895 missense probably benign
IGL01931:Celsr1 APN 15 85907660 missense probably damaging 1.00
IGL01952:Celsr1 APN 15 85963223 missense probably benign 0.35
IGL02090:Celsr1 APN 15 85907721 missense possibly damaging 0.49
IGL02191:Celsr1 APN 15 85979004 missense possibly damaging 0.69
IGL02372:Celsr1 APN 15 85929907 missense probably benign 0.01
IGL02413:Celsr1 APN 15 86031226 missense possibly damaging 0.96
IGL02478:Celsr1 APN 15 85941136 missense possibly damaging 0.68
IGL02507:Celsr1 APN 15 85900688 utr 3 prime probably benign
IGL02508:Celsr1 APN 15 86030617 nonsense probably null
IGL02899:Celsr1 APN 15 86031726 missense probably damaging 0.98
IGL02939:Celsr1 APN 15 85901472 missense probably benign
IGL03212:Celsr1 APN 15 85930677 missense probably benign 0.04
P0028:Celsr1 UTSW 15 85922235 missense probably damaging 1.00
PIT4305001:Celsr1 UTSW 15 85900937 missense possibly damaging 0.87
PIT4480001:Celsr1 UTSW 15 86032414 missense probably damaging 0.99
R0018:Celsr1 UTSW 15 86031042 missense possibly damaging 0.47
R0018:Celsr1 UTSW 15 86031042 missense possibly damaging 0.47
R0038:Celsr1 UTSW 15 85929419 missense possibly damaging 0.65
R0057:Celsr1 UTSW 15 86030762 missense probably benign 0.02
R0060:Celsr1 UTSW 15 85922198 missense probably damaging 0.98
R0060:Celsr1 UTSW 15 85922198 missense probably damaging 0.98
R0279:Celsr1 UTSW 15 85902864 missense probably benign 0.00
R0570:Celsr1 UTSW 15 85903365 missense probably benign 0.18
R0611:Celsr1 UTSW 15 85932323 missense possibly damaging 0.91
R0731:Celsr1 UTSW 15 85901597 missense probably benign
R0792:Celsr1 UTSW 15 85931276 missense probably benign 0.02
R0943:Celsr1 UTSW 15 85903288 missense probably damaging 1.00
R0989:Celsr1 UTSW 15 86031279 missense probably benign 0.39
R1118:Celsr1 UTSW 15 86032047 missense probably damaging 1.00
R1237:Celsr1 UTSW 15 85903974 missense probably benign 0.01
R1239:Celsr1 UTSW 15 85979146 missense probably damaging 0.99
R1405:Celsr1 UTSW 15 85905434 splice site probably null
R1405:Celsr1 UTSW 15 85905434 splice site probably null
R1522:Celsr1 UTSW 15 85931276 missense probably benign 0.02
R1662:Celsr1 UTSW 15 86031062 missense probably damaging 1.00
R1673:Celsr1 UTSW 15 85932457 missense probably benign 0.00
R1795:Celsr1 UTSW 15 86030323 missense probably damaging 0.99
R1799:Celsr1 UTSW 15 86032685 missense probably damaging 1.00
R1858:Celsr1 UTSW 15 86032759 missense probably damaging 1.00
R2040:Celsr1 UTSW 15 86032887 missense probably damaging 1.00
R2050:Celsr1 UTSW 15 86030547 missense probably benign 0.02
R2131:Celsr1 UTSW 15 85963223 missense probably benign 0.35
R2132:Celsr1 UTSW 15 86031967 missense possibly damaging 0.91
R2189:Celsr1 UTSW 15 85979230 missense possibly damaging 0.93
R2192:Celsr1 UTSW 15 85916723 missense possibly damaging 0.93
R4213:Celsr1 UTSW 15 86031807 missense probably damaging 1.00
R4356:Celsr1 UTSW 15 85978827 missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85963133 missense probably benign 0.00
R4414:Celsr1 UTSW 15 85927999 missense probably damaging 1.00
R4416:Celsr1 UTSW 15 85927999 missense probably damaging 1.00
R4645:Celsr1 UTSW 15 85916756 missense probably benign 0.35
R4666:Celsr1 UTSW 15 86030494 missense probably damaging 1.00
R4687:Celsr1 UTSW 15 85932460 missense possibly damaging 0.94
R4735:Celsr1 UTSW 15 85906029 critical splice acceptor site probably null
R4804:Celsr1 UTSW 15 85937953 missense possibly damaging 0.49
R4995:Celsr1 UTSW 15 85937911 missense probably damaging 0.99
R5070:Celsr1 UTSW 15 85939134 missense possibly damaging 0.89
R5218:Celsr1 UTSW 15 85932384 missense probably damaging 1.00
R5280:Celsr1 UTSW 15 85930546 missense probably benign
R5310:Celsr1 UTSW 15 85926222 missense possibly damaging 0.88
R5388:Celsr1 UTSW 15 85925518 missense probably damaging 0.99
R5484:Celsr1 UTSW 15 85931282 missense probably benign 0.00
R5639:Celsr1 UTSW 15 86030767 missense probably damaging 1.00
R5758:Celsr1 UTSW 15 85941264 missense probably benign 0.27
R5778:Celsr1 UTSW 15 86032955 missense probably damaging 1.00
R5893:Celsr1 UTSW 15 85904014 missense probably benign 0.02
R5915:Celsr1 UTSW 15 85937975 missense probably benign
R5915:Celsr1 UTSW 15 86030349 missense probably damaging 0.96
R5932:Celsr1 UTSW 15 86032704 missense probably damaging 1.00
R5950:Celsr1 UTSW 15 86032500 missense probably damaging 1.00
R5975:Celsr1 UTSW 15 85919038 splice site probably null
R6050:Celsr1 UTSW 15 85930611 missense probably benign 0.00
R6117:Celsr1 UTSW 15 85932411 missense probably benign 0.04
R6178:Celsr1 UTSW 15 85901021 missense probably benign 0.08
R6212:Celsr1 UTSW 15 85916687 missense probably benign 0.25
R6307:Celsr1 UTSW 15 85928330 missense probably benign
R6320:Celsr1 UTSW 15 85900959 missense probably benign 0.13
R6349:Celsr1 UTSW 15 86031684 missense probably damaging 1.00
R6478:Celsr1 UTSW 15 85925518 missense probably damaging 0.99
R6504:Celsr1 UTSW 15 85978920 missense probably benign 0.07
R6607:Celsr1 UTSW 15 85963285 missense probably benign
R6615:Celsr1 UTSW 15 85902114 critical splice donor site probably null
R6661:Celsr1 UTSW 15 85918934 missense probably damaging 1.00
R6722:Celsr1 UTSW 15 85905914 critical splice donor site probably null
R6743:Celsr1 UTSW 15 85907598 missense probably damaging 0.96
R6746:Celsr1 UTSW 15 86031495 missense probably damaging 1.00
R6772:Celsr1 UTSW 15 86030782 missense probably benign
R6838:Celsr1 UTSW 15 85939194 missense probably benign
R6886:Celsr1 UTSW 15 86031654 missense probably benign 0.00
R7030:Celsr1 UTSW 15 85905478 missense probably damaging 0.99
R7060:Celsr1 UTSW 15 86032655 missense probably benign 0.07
R7080:Celsr1 UTSW 15 85932451 missense possibly damaging 0.87
R7325:Celsr1 UTSW 15 86033008 missense probably damaging 0.99
R7357:Celsr1 UTSW 15 86030514 missense probably benign 0.00
R7371:Celsr1 UTSW 15 86030674 missense possibly damaging 0.91
R7446:Celsr1 UTSW 15 85907673 missense possibly damaging 0.95
R7465:Celsr1 UTSW 15 86033392 missense probably benign
R7491:Celsr1 UTSW 15 86032518 missense not run
Predicted Primers PCR Primer
(F):5'- AAACCTCCCGTCTTGCTAAG -3'
(R):5'- CATAGTGTCTGGACTCAGGC -3'

Sequencing Primer
(F):5'- CCGTCTTGCTAAGCCTGGAAATG -3'
(R):5'- TGTCTGGACTCAGGCTCTCG -3'
Posted On2018-02-27