Incidental Mutation 'R6187:Olfr1115'
ID502216
Institutional Source Beutler Lab
Gene Symbol Olfr1115
Ensembl Gene ENSMUSG00000070856
Gene Nameolfactory receptor 1115
SynonymsMOR264-20, MOR273-4P, MOR273-4P, Olfr1530-ps1, GA_x6K02T2Q125-48736906-48737886
MMRRC Submission 044327-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6187 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87248013-87253868 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87252698 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 254 (S254T)
Ref Sequence ENSEMBL: ENSMUSP00000150996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081986] [ENSMUST00000213513] [ENSMUST00000214119] [ENSMUST00000217196]
Predicted Effect probably damaging
Transcript: ENSMUST00000081986
AA Change: S254T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080647
Gene: ENSMUSG00000070856
AA Change: S254T

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 5e-54 PFAM
Pfam:7tm_1 56 305 3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183480
Predicted Effect probably damaging
Transcript: ENSMUST00000213513
AA Change: S254T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214119
AA Change: S254T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217196
AA Change: S254T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,270,599 probably benign Het
Abca13 T A 11: 9,309,085 L2937H probably damaging Het
Abca3 A G 17: 24,408,167 I1281V possibly damaging Het
Adam2 A T 14: 66,068,619 S138T possibly damaging Het
Adamts4 C T 1: 171,250,993 P61S probably damaging Het
Adamts6 C T 13: 104,297,425 P121S probably damaging Het
AF529169 A G 9: 89,591,167 I897T probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ak1 G A 2: 32,633,477 V186M probably damaging Het
Alpk1 T C 3: 127,673,342 Y1096C probably damaging Het
Ankrd29 A C 18: 12,279,690 Y73* probably null Het
Asah2 A T 19: 32,024,867 S292R probably damaging Het
Atp6v1b1 A T 6: 83,752,395 T105S probably damaging Het
Axdnd1 T A 1: 156,365,612 probably null Het
Bub1b T G 2: 118,631,000 S678A probably damaging Het
Cenpq T A 17: 40,927,198 M142L probably benign Het
Ciz1 T A 2: 32,370,051 V203E possibly damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Cyp2c68 A T 19: 39,741,008 S12T probably benign Het
Cyp4f18 C A 8: 71,993,186 A322S probably damaging Het
Disp2 A G 2: 118,792,143 S1119G probably damaging Het
Eif2ak4 C T 2: 118,457,157 T1081M probably damaging Het
Faxc A G 4: 21,958,445 T201A possibly damaging Het
Fbxw14 A G 9: 109,276,264 S278P probably damaging Het
Fpr1 G T 17: 17,876,928 C266* probably null Het
Fsip2 T C 2: 82,982,454 I3039T probably benign Het
Gas1 G T 13: 60,176,372 S190R possibly damaging Het
Gemin2 A G 12: 59,013,585 T37A probably damaging Het
Gm21370 T C 13: 120,026,867 I49V probably benign Het
Gm8444 T C 15: 81,843,606 probably benign Het
Gpr1 T C 1: 63,183,275 E267G probably damaging Het
Gria1 A G 11: 57,238,110 D401G possibly damaging Het
Gstk1 G A 6: 42,249,860 V187I possibly damaging Het
Hmcn1 T C 1: 150,630,728 D3776G probably damaging Het
Itfg1 A C 8: 85,836,465 V102G probably damaging Het
Kidins220 A G 12: 25,051,308 probably null Het
Kif13b A C 14: 64,736,215 D338A probably damaging Het
Mab21l2 T C 3: 86,547,258 Y145C probably damaging Het
Magel2 A G 7: 62,377,641 M98V unknown Het
Mdfic T C 6: 15,721,197 probably benign Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mycbp2 A G 14: 103,147,017 L3475P probably damaging Het
Myh14 G A 7: 44,627,033 T1216I probably damaging Het
Nfatc2 T A 2: 168,480,238 I914F probably benign Het
Nupl1 T C 14: 60,240,807 probably null Het
Olfr120 T C 17: 37,726,141 L48P probably damaging Het
Olfr1383 G T 11: 49,523,511 probably benign Het
Olfr469 A T 7: 107,822,574 N298K probably benign Het
Olfr535 A G 7: 140,492,616 probably benign Het
Olfr724 A G 14: 49,961,069 M1T probably null Het
Olfr835 A C 9: 19,035,393 Q90P probably benign Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Oxr1 A G 15: 41,825,919 Q513R probably damaging Het
Padi1 C T 4: 140,826,965 V310M probably damaging Het
Pard3 T C 8: 127,073,273 L11S probably benign Het
Pcdhb14 A T 18: 37,448,444 D201V probably damaging Het
Pcdhb7 A G 18: 37,342,569 R253G probably benign Het
Plxnb2 C T 15: 89,167,258 D253N probably damaging Het
Ppp2cb T C 8: 33,615,474 S171P probably damaging Het
Prr5 C T 15: 84,693,772 T94M probably damaging Het
Rp1 A G 1: 4,349,869 F340S probably damaging Het
Rpa1 C G 11: 75,310,236 G433A probably benign Het
Smg1 A T 7: 118,189,163 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Homo
Svep1 C T 4: 58,072,872 G2146R probably damaging Het
Tas2r106 A G 6: 131,678,210 M226T probably damaging Het
Tbk1 T C 10: 121,584,243 I14V probably benign Het
Tekt4 G C 17: 25,472,223 V168L probably damaging Het
Tnfaip1 T A 11: 78,527,546 T232S probably damaging Het
Trio C T 15: 27,743,952 probably null Het
Ttn T A 2: 76,944,437 Y2133F unknown Het
Uap1l1 C T 2: 25,362,729 R433H probably damaging Het
Ugt2b35 T C 5: 87,007,322 F339L probably damaging Het
Unc5b T C 10: 60,772,224 Y699C probably damaging Het
Vcpip1 T C 1: 9,724,780 H1122R probably damaging Het
Vmn2r91 T C 17: 18,106,626 V391A probably benign Het
Vps13c C T 9: 67,915,657 R1327W probably damaging Het
Yes1 A G 5: 32,645,041 Y100C probably damaging Het
Zfp407 A T 18: 84,559,009 N1326K possibly damaging Het
Zfp518a G A 19: 40,915,446 C1273Y probably benign Het
Zfr AGCAGCAGCAGCAGCTGCTGCTGCAGCAGCA AGCAGCAGCA 15: 12,146,231 probably benign Het
Other mutations in Olfr1115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Olfr1115 APN 2 87252462 missense probably damaging 1.00
IGL01376:Olfr1115 APN 2 87252873 missense possibly damaging 0.58
IGL02167:Olfr1115 APN 2 87252198 missense probably benign 0.18
IGL02224:Olfr1115 APN 2 87252477 missense probably benign 0.42
IGL02388:Olfr1115 APN 2 87251951 missense probably benign
IGL02596:Olfr1115 APN 2 87252129 missense probably damaging 0.98
PIT4131001:Olfr1115 UTSW 2 87252629 missense probably benign 0.01
R0140:Olfr1115 UTSW 2 87252625 missense probably damaging 1.00
R0468:Olfr1115 UTSW 2 87252255 missense probably benign 0.04
R1222:Olfr1115 UTSW 2 87252422 missense probably benign 0.04
R1418:Olfr1115 UTSW 2 87252422 missense probably benign 0.04
R1742:Olfr1115 UTSW 2 87252778 missense probably benign 0.01
R1822:Olfr1115 UTSW 2 87252710 missense possibly damaging 0.91
R2332:Olfr1115 UTSW 2 87252873 missense possibly damaging 0.58
R3123:Olfr1115 UTSW 2 87252791 missense possibly damaging 0.67
R3407:Olfr1115 UTSW 2 87252899 missense probably benign 0.00
R4571:Olfr1115 UTSW 2 87252458 missense possibly damaging 0.67
R4710:Olfr1115 UTSW 2 87252040 missense possibly damaging 0.64
R4889:Olfr1115 UTSW 2 87252647 missense probably damaging 0.97
R5031:Olfr1115 UTSW 2 87252082 missense probably benign
R5288:Olfr1115 UTSW 2 87252483 missense probably benign 0.06
R5385:Olfr1115 UTSW 2 87252483 missense probably benign 0.06
R5386:Olfr1115 UTSW 2 87252483 missense probably benign 0.06
R5669:Olfr1115 UTSW 2 87252441 missense probably benign 0.00
R6226:Olfr1115 UTSW 2 87252392 missense probably benign 0.27
R6598:Olfr1115 UTSW 2 87252756 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAGGTGGGGCAGACATATC -3'
(R):5'- GTGACATCCTTGTTCCTCAGGC -3'

Sequencing Primer
(F):5'- GGGCAGACATATCAGATTTTGTCTC -3'
(R):5'- GTTCCTCAGGCTATATATCAAGGG -3'
Posted On2018-02-27