Incidental Mutation 'R6187:Atp6v1b1'
ID502230
Institutional Source Beutler Lab
Gene Symbol Atp6v1b1
Ensembl Gene ENSMUSG00000006269
Gene NameATPase, H+ transporting, lysosomal V1 subunit B1
SynonymsAtp6b1, Vpp-3, D630039P21Rik, lysosomal 56/58kDa, Vpp3, D630030L16Rik
MMRRC Submission 044327-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6187 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location83742990-83758855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83752395 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 105 (T105S)
Ref Sequence ENSEMBL: ENSMUSP00000145710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006431] [ENSMUST00000205763] [ENSMUST00000206911]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006431
AA Change: T96S

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006431
Gene: ENSMUSG00000006269
AA Change: T96S

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 44 110 1.9e-14 PFAM
Pfam:ATP-synt_ab 167 393 9.4e-68 PFAM
Pfam:ATP-synt_ab_C 410 508 6.9e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205763
AA Change: T105S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206652
Predicted Effect probably benign
Transcript: ENSMUST00000206911
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of two V1 domain B subunit isoforms and is found in the kidney. Mutations in this gene cause distal renal tubular acidosis associated with sensorineural deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation show impaired urinary acidification with a more severe metabolic acidosis and inappropriately alkaline urine after oral acid challenge. However, contrary to expectation, neither hearing nor inner ear morphology areimpaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,270,599 probably benign Het
Abca13 T A 11: 9,309,085 L2937H probably damaging Het
Abca3 A G 17: 24,408,167 I1281V possibly damaging Het
Adam2 A T 14: 66,068,619 S138T possibly damaging Het
Adamts4 C T 1: 171,250,993 P61S probably damaging Het
Adamts6 C T 13: 104,297,425 P121S probably damaging Het
AF529169 A G 9: 89,591,167 I897T probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ak1 G A 2: 32,633,477 V186M probably damaging Het
Alpk1 T C 3: 127,673,342 Y1096C probably damaging Het
Ankrd29 A C 18: 12,279,690 Y73* probably null Het
Asah2 A T 19: 32,024,867 S292R probably damaging Het
Axdnd1 T A 1: 156,365,612 probably null Het
Bub1b T G 2: 118,631,000 S678A probably damaging Het
Cenpq T A 17: 40,927,198 M142L probably benign Het
Ciz1 T A 2: 32,370,051 V203E possibly damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Cyp2c68 A T 19: 39,741,008 S12T probably benign Het
Cyp4f18 C A 8: 71,993,186 A322S probably damaging Het
Disp2 A G 2: 118,792,143 S1119G probably damaging Het
Eif2ak4 C T 2: 118,457,157 T1081M probably damaging Het
Faxc A G 4: 21,958,445 T201A possibly damaging Het
Fbxw14 A G 9: 109,276,264 S278P probably damaging Het
Fpr1 G T 17: 17,876,928 C266* probably null Het
Fsip2 T C 2: 82,982,454 I3039T probably benign Het
Gas1 G T 13: 60,176,372 S190R possibly damaging Het
Gemin2 A G 12: 59,013,585 T37A probably damaging Het
Gm21370 T C 13: 120,026,867 I49V probably benign Het
Gm8444 T C 15: 81,843,606 probably benign Het
Gpr1 T C 1: 63,183,275 E267G probably damaging Het
Gria1 A G 11: 57,238,110 D401G possibly damaging Het
Gstk1 G A 6: 42,249,860 V187I possibly damaging Het
Hmcn1 T C 1: 150,630,728 D3776G probably damaging Het
Itfg1 A C 8: 85,836,465 V102G probably damaging Het
Kidins220 A G 12: 25,051,308 probably null Het
Kif13b A C 14: 64,736,215 D338A probably damaging Het
Mab21l2 T C 3: 86,547,258 Y145C probably damaging Het
Magel2 A G 7: 62,377,641 M98V unknown Het
Mdfic T C 6: 15,721,197 probably benign Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mycbp2 A G 14: 103,147,017 L3475P probably damaging Het
Myh14 G A 7: 44,627,033 T1216I probably damaging Het
Nfatc2 T A 2: 168,480,238 I914F probably benign Het
Nupl1 T C 14: 60,240,807 probably null Het
Olfr1115 T A 2: 87,252,698 S254T probably damaging Het
Olfr120 T C 17: 37,726,141 L48P probably damaging Het
Olfr1383 G T 11: 49,523,511 probably benign Het
Olfr469 A T 7: 107,822,574 N298K probably benign Het
Olfr535 A G 7: 140,492,616 probably benign Het
Olfr724 A G 14: 49,961,069 M1T probably null Het
Olfr835 A C 9: 19,035,393 Q90P probably benign Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Oxr1 A G 15: 41,825,919 Q513R probably damaging Het
Padi1 C T 4: 140,826,965 V310M probably damaging Het
Pard3 T C 8: 127,073,273 L11S probably benign Het
Pcdhb14 A T 18: 37,448,444 D201V probably damaging Het
Pcdhb7 A G 18: 37,342,569 R253G probably benign Het
Plxnb2 C T 15: 89,167,258 D253N probably damaging Het
Ppp2cb T C 8: 33,615,474 S171P probably damaging Het
Prr5 C T 15: 84,693,772 T94M probably damaging Het
Rp1 A G 1: 4,349,869 F340S probably damaging Het
Rpa1 C G 11: 75,310,236 G433A probably benign Het
Smg1 A T 7: 118,189,163 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Homo
Svep1 C T 4: 58,072,872 G2146R probably damaging Het
Tas2r106 A G 6: 131,678,210 M226T probably damaging Het
Tbk1 T C 10: 121,584,243 I14V probably benign Het
Tekt4 G C 17: 25,472,223 V168L probably damaging Het
Tnfaip1 T A 11: 78,527,546 T232S probably damaging Het
Trio C T 15: 27,743,952 probably null Het
Ttn T A 2: 76,944,437 Y2133F unknown Het
Uap1l1 C T 2: 25,362,729 R433H probably damaging Het
Ugt2b35 T C 5: 87,007,322 F339L probably damaging Het
Unc5b T C 10: 60,772,224 Y699C probably damaging Het
Vcpip1 T C 1: 9,724,780 H1122R probably damaging Het
Vmn2r91 T C 17: 18,106,626 V391A probably benign Het
Vps13c C T 9: 67,915,657 R1327W probably damaging Het
Yes1 A G 5: 32,645,041 Y100C probably damaging Het
Zfp407 A T 18: 84,559,009 N1326K possibly damaging Het
Zfp518a G A 19: 40,915,446 C1273Y probably benign Het
Zfr AGCAGCAGCAGCAGCTGCTGCTGCAGCAGCA AGCAGCAGCA 15: 12,146,231 probably benign Het
Other mutations in Atp6v1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01560:Atp6v1b1 APN 6 83749915 splice site probably benign
IGL02005:Atp6v1b1 APN 6 83753914 unclassified probably benign
IGL02085:Atp6v1b1 APN 6 83753915 unclassified probably benign
IGL02100:Atp6v1b1 APN 6 83758444 missense probably damaging 1.00
IGL02267:Atp6v1b1 APN 6 83756909 missense probably benign 0.44
IGL02507:Atp6v1b1 APN 6 83756855 missense possibly damaging 0.95
IGL02563:Atp6v1b1 APN 6 83755451 missense probably benign 0.14
IGL03144:Atp6v1b1 APN 6 83758351 missense probably benign 0.02
R0391:Atp6v1b1 UTSW 6 83756921 missense possibly damaging 0.93
R0420:Atp6v1b1 UTSW 6 83752844 unclassified probably benign
R0458:Atp6v1b1 UTSW 6 83752408 missense probably damaging 1.00
R0561:Atp6v1b1 UTSW 6 83753811 missense probably damaging 1.00
R0947:Atp6v1b1 UTSW 6 83753832 missense probably damaging 1.00
R1241:Atp6v1b1 UTSW 6 83756544 unclassified probably benign
R1417:Atp6v1b1 UTSW 6 83753880 missense probably damaging 1.00
R1447:Atp6v1b1 UTSW 6 83757942 missense possibly damaging 0.46
R1710:Atp6v1b1 UTSW 6 83758390 missense probably benign
R1722:Atp6v1b1 UTSW 6 83743092 missense possibly damaging 0.68
R1862:Atp6v1b1 UTSW 6 83749852 critical splice acceptor site probably null
R2086:Atp6v1b1 UTSW 6 83757852 missense probably benign 0.10
R3433:Atp6v1b1 UTSW 6 83743092 missense possibly damaging 0.81
R4193:Atp6v1b1 UTSW 6 83743103 missense probably benign 0.01
R4606:Atp6v1b1 UTSW 6 83752461 missense probably damaging 1.00
R5901:Atp6v1b1 UTSW 6 83758357 missense possibly damaging 0.87
R6156:Atp6v1b1 UTSW 6 83758133 missense probably damaging 1.00
R6717:Atp6v1b1 UTSW 6 83753650 intron probably null
R6727:Atp6v1b1 UTSW 6 83751875 unclassified probably benign
R6952:Atp6v1b1 UTSW 6 83754810 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCCATTGTTCAGGTAAGTG -3'
(R):5'- CATTGTAGAGCATGGTCTATGTGC -3'

Sequencing Primer
(F):5'- TGTACCAATTCTAAGAATGAACTCAC -3'
(R):5'- TCTATGTGCTGGGCCCTGC -3'
Posted On2018-02-27