Incidental Mutation 'R6187:Magel2'
ID502233
Institutional Source Beutler Lab
Gene Symbol Magel2
Ensembl Gene ENSMUSG00000056972
Gene Namemelanoma antigen, family L, 2
SynonymsnM15, ns7, NDNL1, Mage-l2
MMRRC Submission 044327-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6187 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location62377010-62381640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62377641 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 98 (M98V)
Ref Sequence ENSEMBL: ENSMUSP00000079265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080403]
Predicted Effect unknown
Transcript: ENSMUST00000080403
AA Change: M98V
SMART Domains Protein: ENSMUSP00000079265
Gene: ENSMUSG00000056972
AA Change: M98V

DomainStartEndE-ValueType
low complexity region 30 49 N/A INTRINSIC
low complexity region 51 84 N/A INTRINSIC
internal_repeat_1 85 131 2.45e-10 PROSPERO
low complexity region 134 205 N/A INTRINSIC
internal_repeat_1 222 298 2.45e-10 PROSPERO
internal_repeat_2 289 332 6.32e-5 PROSPERO
low complexity region 347 363 N/A INTRINSIC
low complexity region 467 492 N/A INTRINSIC
internal_repeat_2 494 535 6.32e-5 PROSPERO
low complexity region 560 648 N/A INTRINSIC
low complexity region 675 686 N/A INTRINSIC
low complexity region 761 785 N/A INTRINSIC
low complexity region 903 920 N/A INTRINSIC
MAGE 1059 1229 6.82e-65 SMART
low complexity region 1262 1284 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207232
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prader-Willi syndrome (PWS) is caused by the loss of expression of imprinted genes in chromosome 15q11-q13 region. Affected individuals exhibit neonatal hypotonia, developmental delay, and childhood-onset obesity. Necdin (NDN), a gene involved in the terminal differentiation of neurons, localizes to this region of the genome and has been implicated as one of the genes responsible for the etiology of PWS. This gene is structurally similar to NDN, is also localized to the PWS chromosomal region, and is paternally imprinted, suggesting a possible role for it in PWS. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice heterozygous for a null allele that is inherited paternally exhibit some postnatal lethality, reduced male fertility, abnormal circadian rhythm, and hypoactivity. Mice heterozygous for another paternal knock-out allele exhibit 50% neonatal lethalityassociated with weak suckling activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,270,599 probably benign Het
Abca13 T A 11: 9,309,085 L2937H probably damaging Het
Abca3 A G 17: 24,408,167 I1281V possibly damaging Het
Adam2 A T 14: 66,068,619 S138T possibly damaging Het
Adamts4 C T 1: 171,250,993 P61S probably damaging Het
Adamts6 C T 13: 104,297,425 P121S probably damaging Het
AF529169 A G 9: 89,591,167 I897T probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ak1 G A 2: 32,633,477 V186M probably damaging Het
Alpk1 T C 3: 127,673,342 Y1096C probably damaging Het
Ankrd29 A C 18: 12,279,690 Y73* probably null Het
Asah2 A T 19: 32,024,867 S292R probably damaging Het
Atp6v1b1 A T 6: 83,752,395 T105S probably damaging Het
Axdnd1 T A 1: 156,365,612 probably null Het
Bub1b T G 2: 118,631,000 S678A probably damaging Het
Cenpq T A 17: 40,927,198 M142L probably benign Het
Ciz1 T A 2: 32,370,051 V203E possibly damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Cyp2c68 A T 19: 39,741,008 S12T probably benign Het
Cyp4f18 C A 8: 71,993,186 A322S probably damaging Het
Disp2 A G 2: 118,792,143 S1119G probably damaging Het
Eif2ak4 C T 2: 118,457,157 T1081M probably damaging Het
Faxc A G 4: 21,958,445 T201A possibly damaging Het
Fbxw14 A G 9: 109,276,264 S278P probably damaging Het
Fpr1 G T 17: 17,876,928 C266* probably null Het
Fsip2 T C 2: 82,982,454 I3039T probably benign Het
Gas1 G T 13: 60,176,372 S190R possibly damaging Het
Gemin2 A G 12: 59,013,585 T37A probably damaging Het
Gm21370 T C 13: 120,026,867 I49V probably benign Het
Gm8444 T C 15: 81,843,606 probably benign Het
Gpr1 T C 1: 63,183,275 E267G probably damaging Het
Gria1 A G 11: 57,238,110 D401G possibly damaging Het
Gstk1 G A 6: 42,249,860 V187I possibly damaging Het
Hmcn1 T C 1: 150,630,728 D3776G probably damaging Het
Itfg1 A C 8: 85,836,465 V102G probably damaging Het
Kidins220 A G 12: 25,051,308 probably null Het
Kif13b A C 14: 64,736,215 D338A probably damaging Het
Mab21l2 T C 3: 86,547,258 Y145C probably damaging Het
Mdfic T C 6: 15,721,197 probably benign Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mycbp2 A G 14: 103,147,017 L3475P probably damaging Het
Myh14 G A 7: 44,627,033 T1216I probably damaging Het
Nfatc2 T A 2: 168,480,238 I914F probably benign Het
Nupl1 T C 14: 60,240,807 probably null Het
Olfr1115 T A 2: 87,252,698 S254T probably damaging Het
Olfr120 T C 17: 37,726,141 L48P probably damaging Het
Olfr1383 G T 11: 49,523,511 probably benign Het
Olfr469 A T 7: 107,822,574 N298K probably benign Het
Olfr535 A G 7: 140,492,616 probably benign Het
Olfr724 A G 14: 49,961,069 M1T probably null Het
Olfr835 A C 9: 19,035,393 Q90P probably benign Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Oxr1 A G 15: 41,825,919 Q513R probably damaging Het
Padi1 C T 4: 140,826,965 V310M probably damaging Het
Pard3 T C 8: 127,073,273 L11S probably benign Het
Pcdhb14 A T 18: 37,448,444 D201V probably damaging Het
Pcdhb7 A G 18: 37,342,569 R253G probably benign Het
Plxnb2 C T 15: 89,167,258 D253N probably damaging Het
Ppp2cb T C 8: 33,615,474 S171P probably damaging Het
Prr5 C T 15: 84,693,772 T94M probably damaging Het
Rp1 A G 1: 4,349,869 F340S probably damaging Het
Rpa1 C G 11: 75,310,236 G433A probably benign Het
Smg1 A T 7: 118,189,163 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Homo
Svep1 C T 4: 58,072,872 G2146R probably damaging Het
Tas2r106 A G 6: 131,678,210 M226T probably damaging Het
Tbk1 T C 10: 121,584,243 I14V probably benign Het
Tekt4 G C 17: 25,472,223 V168L probably damaging Het
Tnfaip1 T A 11: 78,527,546 T232S probably damaging Het
Trio C T 15: 27,743,952 probably null Het
Ttn T A 2: 76,944,437 Y2133F unknown Het
Uap1l1 C T 2: 25,362,729 R433H probably damaging Het
Ugt2b35 T C 5: 87,007,322 F339L probably damaging Het
Unc5b T C 10: 60,772,224 Y699C probably damaging Het
Vcpip1 T C 1: 9,724,780 H1122R probably damaging Het
Vmn2r91 T C 17: 18,106,626 V391A probably benign Het
Vps13c C T 9: 67,915,657 R1327W probably damaging Het
Yes1 A G 5: 32,645,041 Y100C probably damaging Het
Zfp407 A T 18: 84,559,009 N1326K possibly damaging Het
Zfp518a G A 19: 40,915,446 C1273Y probably benign Het
Zfr AGCAGCAGCAGCAGCTGCTGCTGCAGCAGCA AGCAGCAGCA 15: 12,146,231 probably benign Het
Other mutations in Magel2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Magel2 APN 7 62379322 missense unknown
IGL01391:Magel2 APN 7 62380884 missense unknown
IGL01876:Magel2 APN 7 62378827 missense possibly damaging 0.68
IGL02613:Magel2 APN 7 62380198 missense unknown
IGL02617:Magel2 APN 7 62380198 missense unknown
IGL03256:Magel2 APN 7 62380414 missense unknown
IGL03382:Magel2 APN 7 62378713 missense probably benign 0.00
astroclast2 UTSW 7 62380159 missense unknown
IGL02837:Magel2 UTSW 7 62378260 missense possibly damaging 0.93
R0398:Magel2 UTSW 7 62380551 nonsense probably null
R0463:Magel2 UTSW 7 62378030 missense possibly damaging 0.53
R1033:Magel2 UTSW 7 62380050 missense unknown
R1271:Magel2 UTSW 7 62381014 missense unknown
R1518:Magel2 UTSW 7 62380440 missense unknown
R1539:Magel2 UTSW 7 62378809 missense possibly damaging 0.91
R1682:Magel2 UTSW 7 62380235 missense unknown
R1686:Magel2 UTSW 7 62378240 missense possibly damaging 0.53
R1782:Magel2 UTSW 7 62380857 nonsense probably null
R1785:Magel2 UTSW 7 62377738 missense unknown
R1786:Magel2 UTSW 7 62377738 missense unknown
R1950:Magel2 UTSW 7 62378415 missense possibly damaging 0.48
R2001:Magel2 UTSW 7 62379096 missense unknown
R2002:Magel2 UTSW 7 62379096 missense unknown
R2018:Magel2 UTSW 7 62379096 missense unknown
R2019:Magel2 UTSW 7 62379096 missense unknown
R2029:Magel2 UTSW 7 62380594 missense unknown
R2070:Magel2 UTSW 7 62379096 missense unknown
R2131:Magel2 UTSW 7 62377738 missense unknown
R2132:Magel2 UTSW 7 62377738 missense unknown
R2133:Magel2 UTSW 7 62377738 missense unknown
R2134:Magel2 UTSW 7 62379096 missense unknown
R2155:Magel2 UTSW 7 62380792 missense unknown
R4294:Magel2 UTSW 7 62378767 missense possibly damaging 0.86
R4591:Magel2 UTSW 7 62381089 missense unknown
R4621:Magel2 UTSW 7 62377738 missense unknown
R4816:Magel2 UTSW 7 62381092 missense unknown
R4931:Magel2 UTSW 7 62380624 missense unknown
R5031:Magel2 UTSW 7 62380104 missense unknown
R5034:Magel2 UTSW 7 62379868 missense unknown
R5042:Magel2 UTSW 7 62379606 missense unknown
R5600:Magel2 UTSW 7 62379766 missense unknown
R5769:Magel2 UTSW 7 62378113 missense probably benign 0.02
R5980:Magel2 UTSW 7 62380596 missense unknown
R5987:Magel2 UTSW 7 62378767 missense probably benign 0.33
R6267:Magel2 UTSW 7 62378679 missense probably damaging 0.98
R6270:Magel2 UTSW 7 62380658 nonsense probably null
R6316:Magel2 UTSW 7 62378719 missense possibly damaging 0.68
R6444:Magel2 UTSW 7 62379999 missense unknown
R6452:Magel2 UTSW 7 62380384 missense unknown
R6797:Magel2 UTSW 7 62380159 missense unknown
R6917:Magel2 UTSW 7 62377844 small deletion probably benign
R7011:Magel2 UTSW 7 62378533 missense possibly damaging 0.92
R7025:Magel2 UTSW 7 62379787 missense unknown
R7335:Magel2 UTSW 7 62380776 missense unknown
R7353:Magel2 UTSW 7 62379331 missense unknown
R7413:Magel2 UTSW 7 62377844 small deletion probably benign
R7570:Magel2 UTSW 7 62378910 missense possibly damaging 0.53
Z1088:Magel2 UTSW 7 62378977 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GCAGCTAAGTACGAATCTGGG -3'
(R):5'- AGGATGGGTCATAGGGTTCC -3'

Sequencing Primer
(F):5'- AGTGCCTGCAGTCCATAGC -3'
(R):5'- TCATAGGGTTCCCAGGAGG -3'
Posted On2018-02-27