Incidental Mutation 'R6187:Plxnb2'
ID502270
Institutional Source Beutler Lab
Gene Symbol Plxnb2
Ensembl Gene ENSMUSG00000036606
Gene Nameplexin B2
SynonymsDebt, 1110007H23Rik
MMRRC Submission 044327-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R6187 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89155549-89180788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89167258 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 253 (D253N)
Ref Sequence ENSEMBL: ENSMUSP00000104955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]
Predicted Effect probably damaging
Transcript: ENSMUST00000060808
AA Change: D253N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: D253N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1275 1809 1.6e-225 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109331
AA Change: D253N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: D253N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1274 1809 4.4e-251 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197760
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,270,599 probably benign Het
Abca13 T A 11: 9,309,085 L2937H probably damaging Het
Abca3 A G 17: 24,408,167 I1281V possibly damaging Het
Adam2 A T 14: 66,068,619 S138T possibly damaging Het
Adamts4 C T 1: 171,250,993 P61S probably damaging Het
Adamts6 C T 13: 104,297,425 P121S probably damaging Het
AF529169 A G 9: 89,591,167 I897T probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ak1 G A 2: 32,633,477 V186M probably damaging Het
Alpk1 T C 3: 127,673,342 Y1096C probably damaging Het
Ankrd29 A C 18: 12,279,690 Y73* probably null Het
Asah2 A T 19: 32,024,867 S292R probably damaging Het
Atp6v1b1 A T 6: 83,752,395 T105S probably damaging Het
Axdnd1 T A 1: 156,365,612 probably null Het
Bub1b T G 2: 118,631,000 S678A probably damaging Het
Cenpq T A 17: 40,927,198 M142L probably benign Het
Ciz1 T A 2: 32,370,051 V203E possibly damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Cyp2c68 A T 19: 39,741,008 S12T probably benign Het
Cyp4f18 C A 8: 71,993,186 A322S probably damaging Het
Disp2 A G 2: 118,792,143 S1119G probably damaging Het
Eif2ak4 C T 2: 118,457,157 T1081M probably damaging Het
Faxc A G 4: 21,958,445 T201A possibly damaging Het
Fbxw14 A G 9: 109,276,264 S278P probably damaging Het
Fpr1 G T 17: 17,876,928 C266* probably null Het
Fsip2 T C 2: 82,982,454 I3039T probably benign Het
Gas1 G T 13: 60,176,372 S190R possibly damaging Het
Gemin2 A G 12: 59,013,585 T37A probably damaging Het
Gm21370 T C 13: 120,026,867 I49V probably benign Het
Gm8444 T C 15: 81,843,606 probably benign Het
Gpr1 T C 1: 63,183,275 E267G probably damaging Het
Gria1 A G 11: 57,238,110 D401G possibly damaging Het
Gstk1 G A 6: 42,249,860 V187I possibly damaging Het
Hmcn1 T C 1: 150,630,728 D3776G probably damaging Het
Itfg1 A C 8: 85,836,465 V102G probably damaging Het
Kidins220 A G 12: 25,051,308 probably null Het
Kif13b A C 14: 64,736,215 D338A probably damaging Het
Mab21l2 T C 3: 86,547,258 Y145C probably damaging Het
Magel2 A G 7: 62,377,641 M98V unknown Het
Mdfic T C 6: 15,721,197 probably benign Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mycbp2 A G 14: 103,147,017 L3475P probably damaging Het
Myh14 G A 7: 44,627,033 T1216I probably damaging Het
Nfatc2 T A 2: 168,480,238 I914F probably benign Het
Nupl1 T C 14: 60,240,807 probably null Het
Olfr1115 T A 2: 87,252,698 S254T probably damaging Het
Olfr120 T C 17: 37,726,141 L48P probably damaging Het
Olfr1383 G T 11: 49,523,511 probably benign Het
Olfr469 A T 7: 107,822,574 N298K probably benign Het
Olfr535 A G 7: 140,492,616 probably benign Het
Olfr724 A G 14: 49,961,069 M1T probably null Het
Olfr835 A C 9: 19,035,393 Q90P probably benign Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Oxr1 A G 15: 41,825,919 Q513R probably damaging Het
Padi1 C T 4: 140,826,965 V310M probably damaging Het
Pard3 T C 8: 127,073,273 L11S probably benign Het
Pcdhb14 A T 18: 37,448,444 D201V probably damaging Het
Pcdhb7 A G 18: 37,342,569 R253G probably benign Het
Ppp2cb T C 8: 33,615,474 S171P probably damaging Het
Prr5 C T 15: 84,693,772 T94M probably damaging Het
Rp1 A G 1: 4,349,869 F340S probably damaging Het
Rpa1 C G 11: 75,310,236 G433A probably benign Het
Smg1 A T 7: 118,189,163 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Homo
Svep1 C T 4: 58,072,872 G2146R probably damaging Het
Tas2r106 A G 6: 131,678,210 M226T probably damaging Het
Tbk1 T C 10: 121,584,243 I14V probably benign Het
Tekt4 G C 17: 25,472,223 V168L probably damaging Het
Tnfaip1 T A 11: 78,527,546 T232S probably damaging Het
Trio C T 15: 27,743,952 probably null Het
Ttn T A 2: 76,944,437 Y2133F unknown Het
Uap1l1 C T 2: 25,362,729 R433H probably damaging Het
Ugt2b35 T C 5: 87,007,322 F339L probably damaging Het
Unc5b T C 10: 60,772,224 Y699C probably damaging Het
Vcpip1 T C 1: 9,724,780 H1122R probably damaging Het
Vmn2r91 T C 17: 18,106,626 V391A probably benign Het
Vps13c C T 9: 67,915,657 R1327W probably damaging Het
Yes1 A G 5: 32,645,041 Y100C probably damaging Het
Zfp407 A T 18: 84,559,009 N1326K possibly damaging Het
Zfp518a G A 19: 40,915,446 C1273Y probably benign Het
Zfr AGCAGCAGCAGCAGCTGCTGCTGCAGCAGCA AGCAGCAGCA 15: 12,146,231 probably benign Het
Other mutations in Plxnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Plxnb2 APN 15 89162366 splice site probably benign
IGL01574:Plxnb2 APN 15 89162683 splice site probably null
IGL01695:Plxnb2 APN 15 89157214 missense possibly damaging 0.96
IGL01763:Plxnb2 APN 15 89161981 splice site probably null
IGL01921:Plxnb2 APN 15 89164271 missense possibly damaging 0.78
IGL02129:Plxnb2 APN 15 89160410 missense probably benign 0.04
IGL02153:Plxnb2 APN 15 89165813 nonsense probably null
IGL02637:Plxnb2 APN 15 89164057 missense possibly damaging 0.53
IGL02892:Plxnb2 APN 15 89161222 critical splice donor site probably null
IGL03108:Plxnb2 APN 15 89158031 missense probably benign 0.32
IGL03115:Plxnb2 APN 15 89162438 splice site probably benign
P0040:Plxnb2 UTSW 15 89162935 missense probably damaging 1.00
R0022:Plxnb2 UTSW 15 89163276 critical splice donor site probably null
R0095:Plxnb2 UTSW 15 89165331 missense probably benign
R0103:Plxnb2 UTSW 15 89161769 missense possibly damaging 0.85
R0544:Plxnb2 UTSW 15 89158613 splice site probably benign
R0671:Plxnb2 UTSW 15 89157981 missense probably benign 0.14
R1279:Plxnb2 UTSW 15 89162321 missense probably benign 0.02
R1530:Plxnb2 UTSW 15 89167192 missense probably benign
R1542:Plxnb2 UTSW 15 89165921 missense probably damaging 1.00
R1610:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R1686:Plxnb2 UTSW 15 89162462 missense probably damaging 1.00
R1702:Plxnb2 UTSW 15 89161984 critical splice donor site probably null
R1996:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R1997:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R2031:Plxnb2 UTSW 15 89162810 nonsense probably null
R2049:Plxnb2 UTSW 15 89159002 missense probably damaging 1.00
R2072:Plxnb2 UTSW 15 89158451 missense probably damaging 1.00
R2076:Plxnb2 UTSW 15 89158026 missense probably damaging 1.00
R2140:Plxnb2 UTSW 15 89156562 missense probably benign 0.04
R2418:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R2419:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R3752:Plxnb2 UTSW 15 89157255 splice site probably benign
R3825:Plxnb2 UTSW 15 89166399 missense probably benign 0.05
R4154:Plxnb2 UTSW 15 89159642 missense probably damaging 0.98
R4197:Plxnb2 UTSW 15 89157018 missense probably damaging 1.00
R4385:Plxnb2 UTSW 15 89160623 missense probably damaging 0.96
R4434:Plxnb2 UTSW 15 89162803 missense probably damaging 1.00
R4678:Plxnb2 UTSW 15 89160928 missense probably benign 0.37
R4717:Plxnb2 UTSW 15 89157419 nonsense probably null
R4773:Plxnb2 UTSW 15 89166947 missense probably benign 0.06
R4905:Plxnb2 UTSW 15 89157411 missense probably damaging 1.00
R5368:Plxnb2 UTSW 15 89159593 missense possibly damaging 0.94
R5418:Plxnb2 UTSW 15 89166491 missense probably benign 0.00
R5484:Plxnb2 UTSW 15 89164209 splice site probably null
R5520:Plxnb2 UTSW 15 89167543 missense possibly damaging 0.65
R5566:Plxnb2 UTSW 15 89164020 missense probably benign 0.05
R5568:Plxnb2 UTSW 15 89157435 missense probably damaging 1.00
R5619:Plxnb2 UTSW 15 89162809 missense possibly damaging 0.92
R5685:Plxnb2 UTSW 15 89167032 missense probably damaging 1.00
R5688:Plxnb2 UTSW 15 89158696 missense probably damaging 1.00
R5809:Plxnb2 UTSW 15 89167571 missense possibly damaging 0.61
R5813:Plxnb2 UTSW 15 89160759 missense possibly damaging 0.81
R5866:Plxnb2 UTSW 15 89167572 missense probably damaging 1.00
R6016:Plxnb2 UTSW 15 89161022 missense possibly damaging 0.55
R6117:Plxnb2 UTSW 15 89158000 missense probably benign 0.04
R6260:Plxnb2 UTSW 15 89165291 missense probably benign 0.22
R6263:Plxnb2 UTSW 15 89161986 missense probably damaging 0.99
R6269:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
R6351:Plxnb2 UTSW 15 89157770 missense possibly damaging 0.95
R6522:Plxnb2 UTSW 15 89164426 missense probably benign 0.18
R6856:Plxnb2 UTSW 15 89164320 missense probably benign 0.27
R6930:Plxnb2 UTSW 15 89160389 missense probably benign
R7354:Plxnb2 UTSW 15 89165725 missense possibly damaging 0.92
X0027:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TTATCTAGCGGGAACACACAGAG -3'
(R):5'- ATGGTATCATCGTGAGCACC -3'

Sequencing Primer
(F):5'- GGAACACACAGAGGCCCG -3'
(R):5'- TGCTGGACAGGGCTGAG -3'
Posted On2018-02-27