Incidental Mutation 'R6188:Duox1'
ID502297
Institutional Source Beutler Lab
Gene Symbol Duox1
Ensembl Gene ENSMUSG00000033268
Gene Namedual oxidase 1
SynonymsTHOX1, LNOX1, 9930101G15Rik, NOXEF1
MMRRC Submission 044328-MU
Accession Numbers

Genbank: NM_001099297; MGI: 2139422

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6188 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location122315672-122347972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122319794 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 168 (Q168R)
Ref Sequence ENSEMBL: ENSMUSP00000097060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099461]
Predicted Effect probably benign
Transcript: ENSMUST00000099461
AA Change: Q168R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: Q168R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:An_peroxidase 29 557 2.1e-134 PFAM
transmembrane domain 594 616 N/A INTRINSIC
EFh 819 847 1.82e-4 SMART
EFh 855 883 3.45e-5 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Ferric_reduct 1087 1236 5.3e-21 PFAM
Pfam:FAD_binding_8 1272 1374 8.5e-21 PFAM
Pfam:NAD_binding_6 1380 1534 3.5e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

 

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,731 I88F possibly damaging Het
4930407I10Rik T C 15: 82,059,270 S28P probably benign Het
4930504O13Rik T C 11: 58,446,356 E97G probably benign Het
4931408C20Rik T A 1: 26,685,703 Y132F probably damaging Het
4932415D10Rik A G 10: 82,285,257 I3973T probably damaging Het
a A T 2: 155,047,682 N56I probably damaging Het
Apoe C A 7: 19,698,380 probably benign Het
Aspm C A 1: 139,479,239 R1955S possibly damaging Het
Boc G A 16: 44,499,548 L358F possibly damaging Het
Cadm2 A T 16: 66,815,307 probably null Het
Ccdc183 T C 2: 25,609,752 E384G probably benign Het
Ccl12 A G 11: 82,103,117 T67A probably damaging Het
Cep120 T C 18: 53,724,457 D312G probably benign Het
Cmya5 A G 13: 93,093,444 V1712A possibly damaging Het
Cmya5 A G 13: 93,097,276 S435P possibly damaging Het
Dmbt1 A T 7: 131,097,631 N997Y probably damaging Het
Dock2 T A 11: 34,503,396 I86F probably damaging Het
Epb41l4a T A 18: 33,832,665 I370L probably benign Het
Erc2 T A 14: 28,317,251 D950E probably damaging Het
Exoc6b A G 6: 84,855,497 V405A probably damaging Het
F13a1 T C 13: 37,025,778 D71G probably benign Het
Fam151a A T 4: 106,745,499 Y205F possibly damaging Het
Fcnb C A 2: 28,079,190 R165M possibly damaging Het
Fndc3a C T 14: 72,589,961 V50I probably damaging Het
Gm13276 C T 4: 88,785,859 Q51* probably null Het
Grik1 T C 16: 88,056,071 T75A probably benign Het
Grip2 A G 6: 91,763,533 L1015P probably damaging Het
Hnrnpk A G 13: 58,394,153 F339L probably benign Het
Iqgap3 A G 3: 88,098,893 D537G probably benign Het
Kars C T 8: 112,008,481 probably null Het
Kpna7 G T 5: 144,992,844 N390K probably damaging Het
Krt36 A T 11: 100,102,420 S410T probably benign Het
Lingo4 A G 3: 94,402,850 E365G probably damaging Het
Liph T C 16: 21,984,268 D17G probably benign Het
Lmbrd1 C A 1: 24,711,545 N166K probably benign Het
Nup155 T C 15: 8,109,575 S44P probably damaging Het
Olfr1245 A T 2: 89,575,194 C177* probably null Het
Olfr1441 A G 19: 12,422,610 I100M probably benign Het
Olfr164 A G 16: 19,286,557 M62T probably damaging Het
Pcdhga6 T C 18: 37,708,271 V348A probably benign Het
Phc3 G A 3: 30,937,049 Q295* probably null Het
Phyh A G 2: 4,927,490 E129G probably damaging Het
Polb A G 8: 22,647,447 S96P probably damaging Het
Ppp1r9a A T 6: 5,158,113 K1174* probably null Het
Ppp1r9b C T 11: 94,991,836 R97W probably damaging Het
Pttg1ip T C 10: 77,582,508 probably null Het
Pygm G A 19: 6,397,937 probably null Het
Rgs20 GGAGAGAG GGAGAG 1: 5,020,883 probably null Het
Rlf T C 4: 121,170,766 H111R probably damaging Het
Rmdn3 A G 2: 119,139,350 probably null Het
Ror2 T A 13: 53,111,311 T570S probably damaging Het
Sel1l3 A C 5: 53,155,719 I542R possibly damaging Het
Serpinb3d A G 1: 107,078,507 F284L probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A G 15: 96,692,516 probably null Het
Tet2 T C 3: 133,480,326 S1117G probably benign Het
Trav15-1-dv6-1 C T 14: 53,559,957 A21V probably damaging Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn1r220 A T 13: 23,183,914 L204H probably damaging Het
Vmn1r3 A T 4: 3,185,017 S97T probably damaging Het
Zfp599 A G 9: 22,249,990 F293S probably damaging Het
Zfp983 A G 17: 21,659,019 Y46C probably damaging Het
Other mutations in Duox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Duox1 APN 2 122333141 missense possibly damaging 0.55
IGL00956:Duox1 APN 2 122323306 missense probably benign 0.42
IGL01413:Duox1 APN 2 122320710 missense probably benign 0.03
IGL01444:Duox1 APN 2 122340090 missense probably damaging 0.98
IGL01633:Duox1 APN 2 122333798 missense probably benign 0.00
IGL01814:Duox1 APN 2 122346272 missense probably damaging 0.99
IGL01868:Duox1 APN 2 122338407 missense probably benign
IGL02096:Duox1 APN 2 122344174 missense probably damaging 0.99
IGL02126:Duox1 APN 2 122346336 missense probably benign 0.21
IGL02342:Duox1 APN 2 122347312 missense probably damaging 1.00
IGL02687:Duox1 APN 2 122336415 missense probably damaging 1.00
IGL02708:Duox1 APN 2 122326017 missense possibly damaging 0.81
IGL02935:Duox1 APN 2 122324519 missense possibly damaging 0.56
D4043:Duox1 UTSW 2 122344795 missense probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0241:Duox1 UTSW 2 122333397 splice site probably benign
R0479:Duox1 UTSW 2 122346380 missense probably damaging 1.00
R0834:Duox1 UTSW 2 122346501 missense probably damaging 1.00
R1105:Duox1 UTSW 2 122337702 missense probably damaging 0.97
R1205:Duox1 UTSW 2 122327925 nonsense probably null
R1281:Duox1 UTSW 2 122327088 missense probably damaging 1.00
R1302:Duox1 UTSW 2 122347279 missense probably benign 0.24
R1532:Duox1 UTSW 2 122344723 missense probably damaging 1.00
R1706:Duox1 UTSW 2 122319472 missense probably benign 0.01
R1719:Duox1 UTSW 2 122338644 missense possibly damaging 0.93
R1753:Duox1 UTSW 2 122333429 missense probably damaging 1.00
R1827:Duox1 UTSW 2 122347380 nonsense probably null
R1828:Duox1 UTSW 2 122347380 nonsense probably null
R1940:Duox1 UTSW 2 122325984 missense probably benign 0.06
R1944:Duox1 UTSW 2 122346520 missense probably damaging 0.99
R2069:Duox1 UTSW 2 122333062 missense probably benign
R2113:Duox1 UTSW 2 122337254 missense probably benign
R2202:Duox1 UTSW 2 122344713 missense probably benign 0.19
R2314:Duox1 UTSW 2 122333730 nonsense probably null
R2507:Duox1 UTSW 2 122333138 missense probably benign 0.34
R2508:Duox1 UTSW 2 122333138 missense probably benign 0.34
R3177:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R3277:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R4124:Duox1 UTSW 2 122337421 missense probably damaging 1.00
R4271:Duox1 UTSW 2 122324375 missense probably damaging 0.96
R4411:Duox1 UTSW 2 122337634 missense probably benign 0.30
R4419:Duox1 UTSW 2 122327126 missense probably benign
R4420:Duox1 UTSW 2 122327126 missense probably benign
R4578:Duox1 UTSW 2 122333777 missense probably benign 0.15
R4628:Duox1 UTSW 2 122346252 missense probably damaging 1.00
R4665:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4666:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4730:Duox1 UTSW 2 122333831 missense probably damaging 1.00
R4767:Duox1 UTSW 2 122333441 missense possibly damaging 0.79
R4857:Duox1 UTSW 2 122315731 missense probably benign 0.05
R4904:Duox1 UTSW 2 122320864 missense probably damaging 1.00
R5032:Duox1 UTSW 2 122337317 missense probably benign
R5201:Duox1 UTSW 2 122327922 missense probably benign
R5474:Duox1 UTSW 2 122346625 missense probably benign 0.02
R5835:Duox1 UTSW 2 122327860 missense probably benign 0.00
R5939:Duox1 UTSW 2 122346351 missense probably damaging 1.00
R5941:Duox1 UTSW 2 122344156 missense probably damaging 0.97
R5943:Duox1 UTSW 2 122333435 missense probably benign 0.00
R5970:Duox1 UTSW 2 122340201 missense probably damaging 1.00
R6023:Duox1 UTSW 2 122337684 missense probably benign 0.19
R6050:Duox1 UTSW 2 122319475 missense probably benign 0.00
R6064:Duox1 UTSW 2 122320762 missense probably benign 0.00
R6093:Duox1 UTSW 2 122347274 missense probably benign 0.01
R6246:Duox1 UTSW 2 122327174 missense probably damaging 1.00
R6259:Duox1 UTSW 2 122344783 missense probably benign 0.00
R6290:Duox1 UTSW 2 122333807 missense possibly damaging 0.92
R6300:Duox1 UTSW 2 122337700 missense probably damaging 0.99
R6341:Duox1 UTSW 2 122337721 missense probably damaging 0.98
R6498:Duox1 UTSW 2 122319607 missense probably damaging 1.00
R6883:Duox1 UTSW 2 122324584 intron probably null
R7002:Duox1 UTSW 2 122319877 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTGCTGCCCTTTCAAAG -3'
(R):5'- ATGGACAACAGCTTGAGTCAGG -3'

Sequencing Primer
(F):5'- TTTCAAAGGAGCCGCTGG -3'
(R):5'- AAGCAGCCTGGTGCCTCTAAC -3'
Posted On2018-02-27