Incidental Mutation 'R6188:Rlf'
ID502306
Institutional Source Beutler Lab
Gene Symbol Rlf
Ensembl Gene ENSMUSG00000049878
Gene Namerearranged L-myc fusion sequence
SynonymsMommeD8, 9230110M18Rik
MMRRC Submission 044328-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6188 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location121145373-121215084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121170766 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 111 (H111R)
Ref Sequence ENSEMBL: ENSMUSP00000127068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056635] [ENSMUST00000168615]
Predicted Effect probably damaging
Transcript: ENSMUST00000056635
AA Change: H221R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050825
Gene: ENSMUSG00000049878
AA Change: H221R

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
ZnF_C2H2 554 575 1.27e2 SMART
ZnF_C2H2 581 603 1.08e-1 SMART
ZnF_C2H2 667 692 5.42e-2 SMART
ZnF_C2H2 710 732 8.09e-1 SMART
ZnF_C2H2 738 762 3.99e0 SMART
ZnF_C2H2 767 791 3.16e-3 SMART
ZnF_C2H2 797 821 1.18e-2 SMART
low complexity region 885 909 N/A INTRINSIC
ZnF_C2H2 949 974 2.57e-3 SMART
low complexity region 1055 1066 N/A INTRINSIC
ZnF_C2H2 1122 1147 5.9e-3 SMART
ZnF_C2H2 1167 1190 4.17e-3 SMART
low complexity region 1259 1285 N/A INTRINSIC
ZnF_C2H2 1303 1328 5.06e-2 SMART
ZnF_C2H2 1355 1380 6.57e-1 SMART
ZnF_C2H2 1400 1425 3.83e-2 SMART
ZnF_C2H2 1437 1462 8.81e-2 SMART
low complexity region 1488 1514 N/A INTRINSIC
low complexity region 1521 1533 N/A INTRINSIC
ZnF_C2H2 1556 1581 4.81e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142647
SMART Domains Protein: ENSMUSP00000116831
Gene: ENSMUSG00000049878

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168615
AA Change: H111R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127068
Gene: ENSMUSG00000049878
AA Change: H111R

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 444 465 1.27e2 SMART
ZnF_C2H2 471 493 1.08e-1 SMART
ZnF_C2H2 557 582 5.42e-2 SMART
ZnF_C2H2 600 622 8.09e-1 SMART
ZnF_C2H2 628 652 3.99e0 SMART
ZnF_C2H2 657 681 3.16e-3 SMART
ZnF_C2H2 687 711 1.18e-2 SMART
low complexity region 775 799 N/A INTRINSIC
ZnF_C2H2 839 864 2.57e-3 SMART
low complexity region 945 956 N/A INTRINSIC
ZnF_C2H2 1012 1037 5.9e-3 SMART
ZnF_C2H2 1057 1080 4.17e-3 SMART
low complexity region 1149 1175 N/A INTRINSIC
ZnF_C2H2 1193 1218 5.06e-2 SMART
ZnF_C2H2 1245 1270 6.57e-1 SMART
ZnF_C2H2 1290 1315 3.83e-2 SMART
ZnF_C2H2 1327 1352 8.81e-2 SMART
low complexity region 1378 1404 N/A INTRINSIC
low complexity region 1411 1423 N/A INTRINSIC
ZnF_C2H2 1446 1471 4.81e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic ENU-induced allele exhibit postnatal lethality. Only a few mice survive to weaning age exhibiting a decreased body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,731 I88F possibly damaging Het
4930407I10Rik T C 15: 82,059,270 S28P probably benign Het
4930504O13Rik T C 11: 58,446,356 E97G probably benign Het
4931408C20Rik T A 1: 26,685,703 Y132F probably damaging Het
4932415D10Rik A G 10: 82,285,257 I3973T probably damaging Het
a A T 2: 155,047,682 N56I probably damaging Het
Apoe C A 7: 19,698,380 probably benign Het
Aspm C A 1: 139,479,239 R1955S possibly damaging Het
Boc G A 16: 44,499,548 L358F possibly damaging Het
Cadm2 A T 16: 66,815,307 probably null Het
Ccdc183 T C 2: 25,609,752 E384G probably benign Het
Ccl12 A G 11: 82,103,117 T67A probably damaging Het
Cep120 T C 18: 53,724,457 D312G probably benign Het
Cmya5 A G 13: 93,093,444 V1712A possibly damaging Het
Cmya5 A G 13: 93,097,276 S435P possibly damaging Het
Dmbt1 A T 7: 131,097,631 N997Y probably damaging Het
Dock2 T A 11: 34,503,396 I86F probably damaging Het
Duox1 A G 2: 122,319,794 Q168R probably benign Het
Epb41l4a T A 18: 33,832,665 I370L probably benign Het
Erc2 T A 14: 28,317,251 D950E probably damaging Het
Exoc6b A G 6: 84,855,497 V405A probably damaging Het
F13a1 T C 13: 37,025,778 D71G probably benign Het
Fam151a A T 4: 106,745,499 Y205F possibly damaging Het
Fcnb C A 2: 28,079,190 R165M possibly damaging Het
Fndc3a C T 14: 72,589,961 V50I probably damaging Het
Gm13276 C T 4: 88,785,859 Q51* probably null Het
Grik1 T C 16: 88,056,071 T75A probably benign Het
Grip2 A G 6: 91,763,533 L1015P probably damaging Het
Hnrnpk A G 13: 58,394,153 F339L probably benign Het
Iqgap3 A G 3: 88,098,893 D537G probably benign Het
Kars C T 8: 112,008,481 probably null Het
Kpna7 G T 5: 144,992,844 N390K probably damaging Het
Krt36 A T 11: 100,102,420 S410T probably benign Het
Lingo4 A G 3: 94,402,850 E365G probably damaging Het
Liph T C 16: 21,984,268 D17G probably benign Het
Lmbrd1 C A 1: 24,711,545 N166K probably benign Het
Nup155 T C 15: 8,109,575 S44P probably damaging Het
Olfr1245 A T 2: 89,575,194 C177* probably null Het
Olfr1441 A G 19: 12,422,610 I100M probably benign Het
Olfr164 A G 16: 19,286,557 M62T probably damaging Het
Pcdhga6 T C 18: 37,708,271 V348A probably benign Het
Phc3 G A 3: 30,937,049 Q295* probably null Het
Phyh A G 2: 4,927,490 E129G probably damaging Het
Polb A G 8: 22,647,447 S96P probably damaging Het
Ppp1r9a A T 6: 5,158,113 K1174* probably null Het
Ppp1r9b C T 11: 94,991,836 R97W probably damaging Het
Pttg1ip T C 10: 77,582,508 probably null Het
Pygm G A 19: 6,397,937 probably null Het
Rgs20 GGAGAGAG GGAGAG 1: 5,020,883 probably null Het
Rmdn3 A G 2: 119,139,350 probably null Het
Ror2 T A 13: 53,111,311 T570S probably damaging Het
Sel1l3 A C 5: 53,155,719 I542R possibly damaging Het
Serpinb3d A G 1: 107,078,507 F284L probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A G 15: 96,692,516 probably null Het
Tet2 T C 3: 133,480,326 S1117G probably benign Het
Trav15-1-dv6-1 C T 14: 53,559,957 A21V probably damaging Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn1r220 A T 13: 23,183,914 L204H probably damaging Het
Vmn1r3 A T 4: 3,185,017 S97T probably damaging Het
Zfp599 A G 9: 22,249,990 F293S probably damaging Het
Zfp983 A G 17: 21,659,019 Y46C probably damaging Het
Other mutations in Rlf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Rlf APN 4 121170686 missense possibly damaging 0.89
IGL00558:Rlf APN 4 121150973 missense probably damaging 1.00
IGL00990:Rlf APN 4 121148339 missense possibly damaging 0.87
IGL01625:Rlf APN 4 121188260 missense possibly damaging 0.68
IGL01921:Rlf APN 4 121146746 missense probably damaging 1.00
IGL01986:Rlf APN 4 121148106 missense probably damaging 1.00
IGL02232:Rlf APN 4 121182614 missense probably benign 0.21
IGL02586:Rlf APN 4 121150064 missense probably damaging 1.00
IGL03177:Rlf APN 4 121148079 nonsense probably null
IGL03233:Rlf APN 4 121182600 splice site probably benign
IGL03293:Rlf APN 4 121148330 missense probably benign 0.18
Brady UTSW 4 121148553 nonsense probably null
bunch UTSW 4 121154975 missense probably damaging 1.00
transsubstantiation UTSW 4 121148291 missense probably benign 0.10
wafer UTSW 4 121150532 missense probably benign 0.00
wine UTSW 4 121148172 missense probably damaging 1.00
PIT4651001:Rlf UTSW 4 121150313 missense probably damaging 0.98
R0019:Rlf UTSW 4 121146572 missense possibly damaging 0.46
R0019:Rlf UTSW 4 121146572 missense possibly damaging 0.46
R0039:Rlf UTSW 4 121146842 missense possibly damaging 0.90
R0041:Rlf UTSW 4 121149929 missense probably damaging 1.00
R0041:Rlf UTSW 4 121149929 missense probably damaging 1.00
R0590:Rlf UTSW 4 121170833 splice site probably benign
R1562:Rlf UTSW 4 121150391 missense possibly damaging 0.47
R1585:Rlf UTSW 4 121148291 missense probably benign 0.10
R1627:Rlf UTSW 4 121150000 missense probably benign 0.34
R1709:Rlf UTSW 4 121149823 missense probably benign 0.00
R1968:Rlf UTSW 4 121148420 missense probably damaging 1.00
R1982:Rlf UTSW 4 121150112 missense probably damaging 1.00
R3120:Rlf UTSW 4 121149483 missense probably benign 0.01
R3155:Rlf UTSW 4 121149332 missense probably damaging 1.00
R3162:Rlf UTSW 4 121148847 missense probably damaging 1.00
R3162:Rlf UTSW 4 121148847 missense probably damaging 1.00
R3429:Rlf UTSW 4 121150532 missense probably benign 0.00
R3430:Rlf UTSW 4 121150532 missense probably benign 0.00
R3700:Rlf UTSW 4 121150863 missense possibly damaging 0.77
R3732:Rlf UTSW 4 121148324 missense probably benign
R3909:Rlf UTSW 4 121149032 missense probably benign 0.00
R4033:Rlf UTSW 4 121147343 missense probably damaging 1.00
R4350:Rlf UTSW 4 121149096 missense probably benign 0.16
R4654:Rlf UTSW 4 121150601 missense probably benign 0.28
R4976:Rlf UTSW 4 121147455 missense probably damaging 0.98
R5060:Rlf UTSW 4 121146866 missense probably benign 0.00
R5105:Rlf UTSW 4 121150367 missense probably damaging 1.00
R5119:Rlf UTSW 4 121147455 missense probably damaging 0.98
R5150:Rlf UTSW 4 121148172 missense probably damaging 1.00
R5198:Rlf UTSW 4 121148553 nonsense probably null
R5214:Rlf UTSW 4 121150700 missense probably damaging 1.00
R6084:Rlf UTSW 4 121149215 missense possibly damaging 0.95
R6131:Rlf UTSW 4 121154975 missense probably damaging 1.00
R6313:Rlf UTSW 4 121148610 missense probably damaging 0.99
R6332:Rlf UTSW 4 121148822 missense possibly damaging 0.75
R6341:Rlf UTSW 4 121149360 nonsense probably null
R6413:Rlf UTSW 4 121147325 missense probably damaging 1.00
R6683:Rlf UTSW 4 121147926 missense probably damaging 1.00
R7066:Rlf UTSW 4 121148787 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGTTACCTACTGGACTCACC -3'
(R):5'- GTCTTGAGACTAGAATAAGCACTCAG -3'

Sequencing Primer
(F):5'- TACTGGACTCACCTCCTGAATAG -3'
(R):5'- GAATTACAGGTCATCCTCAGCTG -3'
Posted On2018-02-27