Incidental Mutation 'R6188:Exoc6b'
ID502311
Institutional Source Beutler Lab
Gene Symbol Exoc6b
Ensembl Gene ENSMUSG00000033769
Gene Nameexocyst complex component 6B
SynonymsSec15b, Sec15l2, 4930569O18Rik, G430127E12Rik
MMRRC Submission 044328-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.679) question?
Stock #R6188 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location84618487-85069513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84855497 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 405 (V405A)
Ref Sequence ENSEMBL: ENSMUSP00000125312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160197] [ENSMUST00000162821]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000046334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051531
Predicted Effect probably damaging
Transcript: ENSMUST00000160197
AA Change: V405A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125312
Gene: ENSMUSG00000033769
AA Change: V405A

DomainStartEndE-ValueType
coiled coil region 79 118 N/A INTRINSIC
low complexity region 272 282 N/A INTRINSIC
Pfam:Sec15 464 770 4.5e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162821
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a part of the evolutionarily conserved exocyst, a multimeric protein complex necessary for exocytosis, which in turn, is crucial for cell growth, polarity and migration. Disruption of this gene may be associated with phenotypes exhibiting multiple symptoms including intellectual disability and developmental delay (DD). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,731 I88F possibly damaging Het
4930407I10Rik T C 15: 82,059,270 S28P probably benign Het
4930504O13Rik T C 11: 58,446,356 E97G probably benign Het
4931408C20Rik T A 1: 26,685,703 Y132F probably damaging Het
4932415D10Rik A G 10: 82,285,257 I3973T probably damaging Het
a A T 2: 155,047,682 N56I probably damaging Het
Apoe C A 7: 19,698,380 probably benign Het
Aspm C A 1: 139,479,239 R1955S possibly damaging Het
Boc G A 16: 44,499,548 L358F possibly damaging Het
Cadm2 A T 16: 66,815,307 probably null Het
Ccdc183 T C 2: 25,609,752 E384G probably benign Het
Ccl12 A G 11: 82,103,117 T67A probably damaging Het
Cep120 T C 18: 53,724,457 D312G probably benign Het
Cmya5 A G 13: 93,093,444 V1712A possibly damaging Het
Cmya5 A G 13: 93,097,276 S435P possibly damaging Het
Dmbt1 A T 7: 131,097,631 N997Y probably damaging Het
Dock2 T A 11: 34,503,396 I86F probably damaging Het
Duox1 A G 2: 122,319,794 Q168R probably benign Het
Epb41l4a T A 18: 33,832,665 I370L probably benign Het
Erc2 T A 14: 28,317,251 D950E probably damaging Het
F13a1 T C 13: 37,025,778 D71G probably benign Het
Fam151a A T 4: 106,745,499 Y205F possibly damaging Het
Fcnb C A 2: 28,079,190 R165M possibly damaging Het
Fndc3a C T 14: 72,589,961 V50I probably damaging Het
Gm13276 C T 4: 88,785,859 Q51* probably null Het
Grik1 T C 16: 88,056,071 T75A probably benign Het
Grip2 A G 6: 91,763,533 L1015P probably damaging Het
Hnrnpk A G 13: 58,394,153 F339L probably benign Het
Iqgap3 A G 3: 88,098,893 D537G probably benign Het
Kars C T 8: 112,008,481 probably null Het
Kpna7 G T 5: 144,992,844 N390K probably damaging Het
Krt36 A T 11: 100,102,420 S410T probably benign Het
Lingo4 A G 3: 94,402,850 E365G probably damaging Het
Liph T C 16: 21,984,268 D17G probably benign Het
Lmbrd1 C A 1: 24,711,545 N166K probably benign Het
Nup155 T C 15: 8,109,575 S44P probably damaging Het
Olfr1245 A T 2: 89,575,194 C177* probably null Het
Olfr1441 A G 19: 12,422,610 I100M probably benign Het
Olfr164 A G 16: 19,286,557 M62T probably damaging Het
Pcdhga6 T C 18: 37,708,271 V348A probably benign Het
Phc3 G A 3: 30,937,049 Q295* probably null Het
Phyh A G 2: 4,927,490 E129G probably damaging Het
Polb A G 8: 22,647,447 S96P probably damaging Het
Ppp1r9a A T 6: 5,158,113 K1174* probably null Het
Ppp1r9b C T 11: 94,991,836 R97W probably damaging Het
Pttg1ip T C 10: 77,582,508 probably null Het
Pygm G A 19: 6,397,937 probably null Het
Rgs20 GGAGAGAG GGAGAG 1: 5,020,883 probably null Het
Rlf T C 4: 121,170,766 H111R probably damaging Het
Rmdn3 A G 2: 119,139,350 probably null Het
Ror2 T A 13: 53,111,311 T570S probably damaging Het
Sel1l3 A C 5: 53,155,719 I542R possibly damaging Het
Serpinb3d A G 1: 107,078,507 F284L probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A G 15: 96,692,516 probably null Het
Tet2 T C 3: 133,480,326 S1117G probably benign Het
Trav15-1-dv6-1 C T 14: 53,559,957 A21V probably damaging Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn1r220 A T 13: 23,183,914 L204H probably damaging Het
Vmn1r3 A T 4: 3,185,017 S97T probably damaging Het
Zfp599 A G 9: 22,249,990 F293S probably damaging Het
Zfp983 A G 17: 21,659,019 Y46C probably damaging Het
Other mutations in Exoc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Exoc6b APN 6 84989453 missense probably benign 0.08
IGL01148:Exoc6b APN 6 84908226 missense probably benign 0.18
IGL01804:Exoc6b APN 6 84908166 missense probably damaging 0.98
IGL01817:Exoc6b APN 6 85069338 missense probably damaging 1.00
IGL01912:Exoc6b APN 6 84625174 missense probably damaging 1.00
IGL02441:Exoc6b APN 6 85005008 missense probably damaging 1.00
IGL02947:Exoc6b APN 6 84858429 missense probably benign
IGL02996:Exoc6b APN 6 84908213 missense probably benign 0.01
IGL03132:Exoc6b APN 6 84791264 missense possibly damaging 0.46
IGL03338:Exoc6b APN 6 84844130 missense probably damaging 0.99
R0003:Exoc6b UTSW 6 84854699 critical splice donor site probably null
R0732:Exoc6b UTSW 6 84855522 missense probably damaging 0.99
R1137:Exoc6b UTSW 6 84908223 missense probably benign
R1381:Exoc6b UTSW 6 84835117 missense probably benign
R1723:Exoc6b UTSW 6 85069344 missense probably damaging 1.00
R1838:Exoc6b UTSW 6 84853678 missense probably benign 0.04
R1866:Exoc6b UTSW 6 84851914 missense probably damaging 0.99
R2122:Exoc6b UTSW 6 84621482 missense probably benign 0.01
R2138:Exoc6b UTSW 6 84989482 missense probably damaging 1.00
R2357:Exoc6b UTSW 6 84989339 missense possibly damaging 0.60
R2987:Exoc6b UTSW 6 84851947 missense probably damaging 0.96
R2988:Exoc6b UTSW 6 84851947 missense probably damaging 0.96
R3415:Exoc6b UTSW 6 84890565 missense possibly damaging 0.81
R3417:Exoc6b UTSW 6 84890565 missense possibly damaging 0.81
R4364:Exoc6b UTSW 6 85003179 intron probably benign
R4610:Exoc6b UTSW 6 85003159 intron probably benign
R4624:Exoc6b UTSW 6 84854809 splice site probably benign
R4845:Exoc6b UTSW 6 84835137 missense probably benign 0.04
R5366:Exoc6b UTSW 6 84890531 missense probably benign
R5603:Exoc6b UTSW 6 84835144 missense possibly damaging 0.96
R5635:Exoc6b UTSW 6 84851927 missense probably damaging 0.99
R5728:Exoc6b UTSW 6 84860191 missense probably damaging 1.00
R7030:Exoc6b UTSW 6 84848825 missense probably damaging 0.99
R7058:Exoc6b UTSW 6 84854722 missense probably damaging 1.00
R7259:Exoc6b UTSW 6 84848810 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GGTAGGACCACTTACATATGGGAG -3'
(R):5'- ACCTTGTGCTAGGAAATGGTTAG -3'

Sequencing Primer
(F):5'- TTCAAGATAAAGCATGGCATGTGC -3'
(R):5'- TGCTAGGAAATGGTTAGGTTCC -3'
Posted On2018-02-27