Incidental Mutation 'R6190:Eml2'
ID502470
Institutional Source Beutler Lab
Gene Symbol Eml2
Ensembl Gene ENSMUSG00000040811
Gene Nameechinoderm microtubule associated protein like 2
Synonyms1600029N02Rik
MMRRC Submission 044330-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6190 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location19176421-19206482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19201163 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 432 (V432I)
Ref Sequence ENSEMBL: ENSMUSP00000112447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048502] [ENSMUST00000117338] [ENSMUST00000120595] [ENSMUST00000148246]
Predicted Effect probably damaging
Transcript: ENSMUST00000048502
AA Change: V451I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037654
Gene: ENSMUSG00000040811
AA Change: V451I

DomainStartEndE-ValueType
Pfam:HELP 17 65 4.6e-14 PFAM
WD40 113 162 8.36e-2 SMART
WD40 165 210 9.21e0 SMART
WD40 213 252 7.99e-1 SMART
WD40 258 298 3.7e0 SMART
WD40 301 341 3.58e-1 SMART
WD40 385 424 5.52e-2 SMART
WD40 427 465 1.1e1 SMART
WD40 468 507 4.95e-4 SMART
WD40 514 553 4.62e-4 SMART
WD40 579 620 4.75e1 SMART
WD40 626 666 2.67e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117338
AA Change: V624I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112491
Gene: ENSMUSG00000040811
AA Change: V624I

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
coiled coil region 59 106 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
Pfam:HELP 211 285 3.5e-29 PFAM
WD40 286 335 5.5e-4 SMART
WD40 338 383 5.8e-2 SMART
WD40 386 425 5.2e-3 SMART
WD40 431 471 2.4e-2 SMART
WD40 474 514 2.3e-3 SMART
WD40 558 597 3.6e-4 SMART
WD40 600 638 7.1e-2 SMART
WD40 641 680 3.1e-6 SMART
WD40 687 726 3.1e-6 SMART
WD40 752 793 3e-1 SMART
WD40 799 839 1.7e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120595
AA Change: V432I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112447
Gene: ENSMUSG00000040811
AA Change: V432I

DomainStartEndE-ValueType
WD40 94 154 2.48e0 SMART
WD40 157 196 7.99e-1 SMART
WD40 202 242 3.7e0 SMART
WD40 245 285 3.58e-1 SMART
WD40 329 368 5.52e-2 SMART
WD40 371 409 1.1e1 SMART
WD40 412 451 4.95e-4 SMART
WD40 458 497 4.62e-4 SMART
WD40 523 564 4.75e1 SMART
WD40 570 610 2.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148246
SMART Domains Protein: ENSMUSP00000115466
Gene: ENSMUSG00000040811

DomainStartEndE-ValueType
WD40 94 143 8.36e-2 SMART
WD40 146 191 9.21e0 SMART
WD40 194 233 7.99e-1 SMART
WD40 239 279 3.7e0 SMART
WD40 282 322 3.58e-1 SMART
WD40 366 405 5.52e-2 SMART
Meta Mutation Damage Score 0.418 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,605,608 L224Q probably damaging Het
Abcc5 A G 16: 20,392,779 M478T probably benign Het
Acot10 T C 15: 20,665,785 D290G possibly damaging Het
Actr3b A G 5: 25,831,690 Q167R probably benign Het
Actr8 C T 14: 29,991,717 R565* probably null Het
Adcy7 C T 8: 88,325,730 probably null Het
Adgrb3 C T 1: 25,420,647 V576I probably benign Het
Adgrv1 T A 13: 81,459,763 probably null Het
Adgrv1 A T 13: 81,524,779 probably null Het
Ak2 A G 4: 128,999,183 D45G probably damaging Het
Ak9 C G 10: 41,422,407 Q1489E unknown Het
Ak9 A T 10: 41,422,408 Q1489L unknown Het
Akap12 C A 10: 4,356,268 S1026Y possibly damaging Het
Ankhd1 T G 18: 36,611,809 S601A possibly damaging Het
Apba2 A T 7: 64,739,880 E508V probably damaging Het
Arhgap18 A G 10: 26,846,035 M1V probably null Het
Arhgef10l G A 4: 140,542,762 T865M possibly damaging Het
Bdh1 T A 16: 31,449,897 V150D probably damaging Het
Becn1 A G 11: 101,295,374 C135R probably damaging Het
C2cd4d A G 3: 94,363,919 D164G probably benign Het
C87414 A T 5: 93,638,078 N114K probably benign Het
Cacna1e C A 1: 154,486,570 V424F possibly damaging Het
Capn7 C A 14: 31,363,603 T511K probably benign Het
Cdc5l G A 17: 45,408,017 P558S probably benign Het
Cep170 T A 1: 176,782,409 H112L probably damaging Het
Cfap61 C T 2: 145,947,133 T19M probably benign Het
Clca3a1 A G 3: 144,758,060 V152A probably benign Het
Cnot10 G T 9: 114,632,723 T24K probably damaging Het
Cntnap5b T A 1: 100,379,075 I839N possibly damaging Het
Cyp4f13 A T 17: 32,929,873 D299E probably damaging Het
Dclk1 A G 3: 55,487,811 E128G probably damaging Het
Dennd1b T C 1: 139,133,675 I365T probably damaging Het
Dgcr8 T C 16: 18,284,410 T3A probably damaging Het
Dld A C 12: 31,344,848 I58S probably damaging Het
Dlg5 T A 14: 24,190,438 R248S probably damaging Het
Faf1 C T 4: 109,861,815 L373F probably damaging Het
Fam159a A T 4: 108,367,855 I170N probably damaging Het
Fam171b C T 2: 83,876,698 T304I probably benign Het
Fcgrt A T 7: 45,102,198 probably null Het
Gimap9 T C 6: 48,678,351 W291R probably damaging Het
Gm4847 G A 1: 166,630,323 A487V probably damaging Het
Gria4 T A 9: 4,420,199 I888F probably benign Het
Hapln2 T A 3: 88,023,293 I224F probably damaging Het
Herc1 T G 9: 66,376,381 L332R possibly damaging Het
Hmgxb4 T C 8: 75,023,299 V481A probably benign Het
Htr1d T C 4: 136,442,798 S113P probably damaging Het
Ift81 T C 5: 122,551,100 Q651R probably benign Het
Il17ra T C 6: 120,475,273 S199P probably damaging Het
Itih2 T C 2: 10,098,507 N723S probably benign Het
Jak1 A T 4: 101,175,128 V427E probably damaging Het
Krt23 C T 11: 99,485,758 D191N probably damaging Het
Lingo1 T A 9: 56,619,650 I552F possibly damaging Het
Llgl2 G A 11: 115,846,986 R199Q probably benign Het
Lrrc37a G T 11: 103,501,216 Q1128K possibly damaging Het
Lrrc74a T C 12: 86,736,489 V36A probably benign Het
M1ap T A 6: 83,003,896 D254E possibly damaging Het
Mal2 C T 15: 54,571,398 probably benign Het
Mbnl2 A G 14: 120,385,421 T124A probably benign Het
Nfatc1 A G 18: 80,712,670 S33P probably benign Het
Nfkbid A G 7: 30,425,737 N253S probably damaging Het
Ngfr T A 11: 95,574,441 I194F probably benign Het
Nhsl1 A G 10: 18,470,041 probably benign Het
Nol9 T A 4: 152,041,234 I214N possibly damaging Het
Olfr1047 T A 2: 86,228,234 T246S possibly damaging Het
Olfr477 T C 7: 107,991,100 L245P probably damaging Het
Olfr98 A G 17: 37,262,744 S307P probably benign Het
Pax3 C T 1: 78,192,549 S160N possibly damaging Het
Pde3b A G 7: 114,523,032 probably null Het
Pde5a A C 3: 122,729,307 E21A probably benign Het
Plcxd1 A G 5: 110,102,603 E270G probably damaging Het
Plxna1 T A 6: 89,356,604 K348* probably null Het
Prpmp5 T A 6: 132,312,729 H44L unknown Het
Psg21 G T 7: 18,655,001 D55E possibly damaging Het
Rasa1 C A 13: 85,233,695 A493S probably benign Het
Raver2 A G 4: 101,133,617 I396V probably benign Het
Rpa2 A G 4: 132,775,020 K138E probably benign Het
Rsad1 T C 11: 94,548,236 N133D probably damaging Het
Rusc1 T C 3: 89,091,881 D198G probably benign Het
Samsn1 A T 16: 75,870,915 Y258N probably damaging Het
Scap A G 9: 110,374,067 N270D probably benign Het
Smpd4 T C 16: 17,632,013 Y200H probably damaging Het
Steap2 A G 5: 5,675,881 V381A probably damaging Het
Syk C T 13: 52,611,053 T72I probably damaging Het
Tbc1d14 T C 5: 36,571,884 D66G possibly damaging Het
Tcp11 A G 17: 28,071,717 Y223H probably benign Het
Timm9 A G 12: 71,126,350 S8P probably benign Het
Tmpo T C 10: 91,164,207 probably null Het
Vezf1 T C 11: 88,076,186 M81T probably benign Het
Vipr1 T A 9: 121,664,653 W257R probably damaging Het
Vmn1r237 G A 17: 21,314,294 G93D probably damaging Het
Vmn2r6 A G 3: 64,538,003 V678A probably benign Het
Vmn2r85 T C 10: 130,425,461 T336A possibly damaging Het
Xpnpep3 C A 15: 81,438,099 D296E probably benign Het
Zfp35 C A 18: 24,004,061 H487Q probably benign Het
Zfp606 A T 7: 12,494,001 Y625F probably damaging Het
Zfp677 A G 17: 21,397,268 T196A possibly damaging Het
Zmym1 T C 4: 127,047,884 I904V probably damaging Het
Other mutations in Eml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Eml2 APN 7 19206143 missense probably damaging 1.00
IGL00786:Eml2 APN 7 19202582 missense probably damaging 1.00
IGL01084:Eml2 APN 7 19190738 nonsense probably null
IGL01132:Eml2 APN 7 19200539 missense probably damaging 1.00
IGL01678:Eml2 APN 7 19186122 missense probably benign 0.38
IGL01800:Eml2 APN 7 19201197 intron probably benign
IGL02517:Eml2 APN 7 19206130 missense probably damaging 1.00
IGL02607:Eml2 APN 7 19206111 missense probably damaging 1.00
IGL02676:Eml2 APN 7 19184921 nonsense probably null
IGL03082:Eml2 APN 7 19201877 missense probably damaging 1.00
puffery UTSW 7 19201163 missense probably damaging 1.00
R0040:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R0135:Eml2 UTSW 7 19203952 missense probably damaging 1.00
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0362:Eml2 UTSW 7 19190806 unclassified probably null
R0387:Eml2 UTSW 7 19182259 splice site probably null
R0432:Eml2 UTSW 7 19179531 nonsense probably null
R0614:Eml2 UTSW 7 19202591 missense probably damaging 1.00
R0628:Eml2 UTSW 7 19201554 splice site probably benign
R1078:Eml2 UTSW 7 19179762 missense probably benign 0.24
R1531:Eml2 UTSW 7 19196254 missense probably damaging 1.00
R1856:Eml2 UTSW 7 19194061 missense probably damaging 0.97
R1864:Eml2 UTSW 7 19201878 missense probably damaging 1.00
R1937:Eml2 UTSW 7 19203964 missense possibly damaging 0.68
R2032:Eml2 UTSW 7 19202555 missense probably benign 0.03
R2185:Eml2 UTSW 7 19194028 missense probably damaging 1.00
R2419:Eml2 UTSW 7 19176695 unclassified probably benign
R3821:Eml2 UTSW 7 19202986 missense possibly damaging 0.94
R4199:Eml2 UTSW 7 19179439 missense probably benign 0.00
R4411:Eml2 UTSW 7 19182401 critical splice donor site probably null
R4497:Eml2 UTSW 7 19179350 missense probably damaging 1.00
R4885:Eml2 UTSW 7 19204010 missense probably benign 0.05
R4912:Eml2 UTSW 7 19193999 splice site probably null
R5028:Eml2 UTSW 7 19179447 critical splice donor site probably null
R5192:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5196:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5373:Eml2 UTSW 7 19179263 missense possibly damaging 0.92
R5718:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5719:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5720:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5727:Eml2 UTSW 7 19190760 missense probably damaging 0.99
R5841:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5842:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5843:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5844:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6014:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6015:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6017:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6073:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6075:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6126:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6128:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6129:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6189:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6258:Eml2 UTSW 7 19179364 unclassified probably null
R6273:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6289:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6376:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6378:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6381:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6384:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6394:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6435:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6436:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6437:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6476:Eml2 UTSW 7 19196311 missense probably benign 0.26
R6550:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6551:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6552:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6554:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6572:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R6598:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6599:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6704:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6705:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6709:Eml2 UTSW 7 19206211 makesense probably null
R6730:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6734:Eml2 UTSW 7 19200507 missense probably benign 0.35
R6742:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6769:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6770:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6864:Eml2 UTSW 7 19196281 missense probably damaging 0.99
R6878:Eml2 UTSW 7 19200612 missense probably benign 0.08
R7045:Eml2 UTSW 7 19201579 missense probably damaging 1.00
R7260:Eml2 UTSW 7 19200590 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CCAAGAAATGGGGATGGCTTC -3'
(R):5'- TGTGACAGGCTGAGATGAAC -3'

Sequencing Primer
(F):5'- CTTCTGGTGGTTTCTGTAAGGCATC -3'
(R):5'- GGATTGAAGCAGCAGGTT -3'
Posted On2018-02-27