Incidental Mutation 'R6190:Adgrv1'
List |< first << previous [record 7 of 217] next >> last >|
ID502502
Institutional Source Beutler Lab
Gene Symbol Adgrv1
Ensembl Gene ENSMUSG00000069170
Gene Nameadhesion G protein-coupled receptor V1
SynonymsMass1, Mgr1, VLGR1, Gpr98
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6190 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location81095068-81633154 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) T to A at 81459763 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095585]
Predicted Effect probably null
Transcript: ENSMUST00000095585
SMART Domains Protein: ENSMUSP00000093245
Gene: ENSMUSG00000069170

DomainStartEndE-ValueType
Calx_beta 20 116 1.53e-1 SMART
Calx_beta 132 236 1.58e-2 SMART
Calx_beta 251 362 2.33e-2 SMART
Pfam:Calx-beta 380 489 1.1e-3 PFAM
Pfam:Calx-beta 507 616 2.5e-2 PFAM
Pfam:Calx-beta 667 747 9.1e-4 PFAM
Calx_beta 764 862 1.55e-1 SMART
Calx_beta 877 980 1.07e-1 SMART
Calx_beta 994 1094 6.45e-5 SMART
Pfam:Calx-beta 1108 1208 7.4e-4 PFAM
Pfam:Laminin_G_3 1331 1492 4.4e-24 PFAM
Pfam:Calx-beta 1498 1542 6.5e-3 PFAM
Pfam:Calx-beta 1557 1662 1e-6 PFAM
Calx_beta 1706 1805 1.34e-11 SMART
Calx_beta 1846 1948 1.04e-2 SMART
Calx_beta 1962 2075 1.59e-3 SMART
Calx_beta 2103 2202 1.59e-4 SMART
Calx_beta 2218 2320 1.74e-3 SMART
Pfam:Calx-beta 2467 2539 2.1e-4 PFAM
Calx_beta 2576 2672 1.24e-6 SMART
Calx_beta 2687 2786 1.12e-1 SMART
Calx_beta 2810 2921 2.21e-2 SMART
Calx_beta 2945 3044 6.69e-12 SMART
Pfam:Calx-beta 3063 3168 1.2e-5 PFAM
Pfam:Calx-beta 3198 3252 1.2e-1 PFAM
Pfam:EPTP 3391 3434 2.8e-10 PFAM
Pfam:Calx-beta 3577 3623 6.5e-8 PFAM
Pfam:Calx-beta 3637 3737 6e-4 PFAM
Pfam:Calx-beta 3781 3872 6.9e-3 PFAM
Calx_beta 3919 4003 1.18e-2 SMART
Calx_beta 4017 4120 5.44e-2 SMART
Pfam:Calx-beta 4193 4236 2.3e-2 PFAM
Calx_beta 4251 4351 1.43e-20 SMART
Calx_beta 4384 4484 9.46e-3 SMART
Pfam:Calx-beta 4498 4608 2e-2 PFAM
Pfam:Calx-beta 4659 4729 5.1e-2 PFAM
Calx_beta 4989 5089 5.7e-6 SMART
Pfam:Calx-beta 5229 5326 1.9e-6 PFAM
Pfam:Calx-beta 5489 5592 7.2e-5 PFAM
low complexity region 5637 5648 N/A INTRINSIC
GPS 5845 5895 9.48e-3 SMART
Pfam:7tm_2 5902 6141 2.3e-16 PFAM
low complexity region 6227 6240 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor superfamily. The encoded protein contains a 7-transmembrane receptor domain, binds calcium and is expressed in the central nervous system. Mutations in this gene are associated with Usher syndrome 2 and familial febrile seizures. Several alternatively spliced transcripts have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous and a targeted mutation exhibit high sensitivity to audiogenic seizures. Targeted mutant mice lack the ankle links that connect growing stereocilia in the developing cochlear hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,605,608 L224Q probably damaging Het
Abcc5 A G 16: 20,392,779 M478T probably benign Het
Acot10 T C 15: 20,665,785 D290G possibly damaging Het
Actr3b A G 5: 25,831,690 Q167R probably benign Het
Actr8 C T 14: 29,991,717 R565* probably null Het
Adcy7 C T 8: 88,325,730 probably null Het
Adgrb3 C T 1: 25,420,647 V576I probably benign Het
Ak2 A G 4: 128,999,183 D45G probably damaging Het
Ak9 C G 10: 41,422,407 Q1489E unknown Het
Ak9 A T 10: 41,422,408 Q1489L unknown Het
Akap12 C A 10: 4,356,268 S1026Y possibly damaging Het
Ankhd1 T G 18: 36,611,809 S601A possibly damaging Het
Apba2 A T 7: 64,739,880 E508V probably damaging Het
Arhgap18 A G 10: 26,846,035 M1V probably null Het
Arhgef10l G A 4: 140,542,762 T865M possibly damaging Het
Bdh1 T A 16: 31,449,897 V150D probably damaging Het
Becn1 A G 11: 101,295,374 C135R probably damaging Het
C2cd4d A G 3: 94,363,919 D164G probably benign Het
C87414 A T 5: 93,638,078 N114K probably benign Het
Cacna1e C A 1: 154,486,570 V424F possibly damaging Het
Capn7 C A 14: 31,363,603 T511K probably benign Het
Cdc5l G A 17: 45,408,017 P558S probably benign Het
Cep170 T A 1: 176,782,409 H112L probably damaging Het
Cfap61 C T 2: 145,947,133 T19M probably benign Het
Clca3a1 A G 3: 144,758,060 V152A probably benign Het
Cnot10 G T 9: 114,632,723 T24K probably damaging Het
Cntnap5b T A 1: 100,379,075 I839N possibly damaging Het
Cyp4f13 A T 17: 32,929,873 D299E probably damaging Het
Dclk1 A G 3: 55,487,811 E128G probably damaging Het
Dennd1b T C 1: 139,133,675 I365T probably damaging Het
Dgcr8 T C 16: 18,284,410 T3A probably damaging Het
Dld A C 12: 31,344,848 I58S probably damaging Het
Dlg5 T A 14: 24,190,438 R248S probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Faf1 C T 4: 109,861,815 L373F probably damaging Het
Fam159a A T 4: 108,367,855 I170N probably damaging Het
Fam171b C T 2: 83,876,698 T304I probably benign Het
Fcgrt A T 7: 45,102,198 probably null Het
Gimap9 T C 6: 48,678,351 W291R probably damaging Het
Gm4847 G A 1: 166,630,323 A487V probably damaging Het
Gria4 T A 9: 4,420,199 I888F probably benign Het
Hapln2 T A 3: 88,023,293 I224F probably damaging Het
Herc1 T G 9: 66,376,381 L332R possibly damaging Het
Hmgxb4 T C 8: 75,023,299 V481A probably benign Het
Htr1d T C 4: 136,442,798 S113P probably damaging Het
Ift81 T C 5: 122,551,100 Q651R probably benign Het
Il17ra T C 6: 120,475,273 S199P probably damaging Het
Itih2 T C 2: 10,098,507 N723S probably benign Het
Jak1 A T 4: 101,175,128 V427E probably damaging Het
Krt23 C T 11: 99,485,758 D191N probably damaging Het
Lingo1 T A 9: 56,619,650 I552F possibly damaging Het
Llgl2 G A 11: 115,846,986 R199Q probably benign Het
Lrrc37a G T 11: 103,501,216 Q1128K possibly damaging Het
Lrrc74a T C 12: 86,736,489 V36A probably benign Het
M1ap T A 6: 83,003,896 D254E possibly damaging Het
Mal2 C T 15: 54,571,398 probably benign Het
Mbnl2 A G 14: 120,385,421 T124A probably benign Het
Nfatc1 A G 18: 80,712,670 S33P probably benign Het
Nfkbid A G 7: 30,425,737 N253S probably damaging Het
Ngfr T A 11: 95,574,441 I194F probably benign Het
Nhsl1 A G 10: 18,470,041 probably benign Het
Nol9 T A 4: 152,041,234 I214N possibly damaging Het
Olfr1047 T A 2: 86,228,234 T246S possibly damaging Het
Olfr477 T C 7: 107,991,100 L245P probably damaging Het
Olfr98 A G 17: 37,262,744 S307P probably benign Het
Pax3 C T 1: 78,192,549 S160N possibly damaging Het
Pde3b A G 7: 114,523,032 probably null Het
Pde5a A C 3: 122,729,307 E21A probably benign Het
Plcxd1 A G 5: 110,102,603 E270G probably damaging Het
Plxna1 T A 6: 89,356,604 K348* probably null Het
Prpmp5 T A 6: 132,312,729 H44L unknown Het
Psg21 G T 7: 18,655,001 D55E possibly damaging Het
Rasa1 C A 13: 85,233,695 A493S probably benign Het
Raver2 A G 4: 101,133,617 I396V probably benign Het
Rpa2 A G 4: 132,775,020 K138E probably benign Het
Rsad1 T C 11: 94,548,236 N133D probably damaging Het
Rusc1 T C 3: 89,091,881 D198G probably benign Het
Samsn1 A T 16: 75,870,915 Y258N probably damaging Het
Scap A G 9: 110,374,067 N270D probably benign Het
Smpd4 T C 16: 17,632,013 Y200H probably damaging Het
Steap2 A G 5: 5,675,881 V381A probably damaging Het
Syk C T 13: 52,611,053 T72I probably damaging Het
Tbc1d14 T C 5: 36,571,884 D66G possibly damaging Het
Tcp11 A G 17: 28,071,717 Y223H probably benign Het
Timm9 A G 12: 71,126,350 S8P probably benign Het
Tmpo T C 10: 91,164,207 probably null Het
Vezf1 T C 11: 88,076,186 M81T probably benign Het
Vipr1 T A 9: 121,664,653 W257R probably damaging Het
Vmn1r237 G A 17: 21,314,294 G93D probably damaging Het
Vmn2r6 A G 3: 64,538,003 V678A probably benign Het
Vmn2r85 T C 10: 130,425,461 T336A possibly damaging Het
Xpnpep3 C A 15: 81,438,099 D296E probably benign Het
Zfp35 C A 18: 24,004,061 H487Q probably benign Het
Zfp606 A T 7: 12,494,001 Y625F probably damaging Het
Zfp677 A G 17: 21,397,268 T196A possibly damaging Het
Zmym1 T C 4: 127,047,884 I904V probably damaging Het
Other mutations in Adgrv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgrv1 APN 13 81405408 critical splice acceptor site probably null
IGL00090:Adgrv1 APN 13 81578101 missense probably damaging 1.00
IGL00091:Adgrv1 APN 13 81578101 missense probably damaging 1.00
IGL00332:Adgrv1 APN 13 81472877 splice site probably benign
IGL00471:Adgrv1 APN 13 81509542 missense probably damaging 0.99
IGL00476:Adgrv1 APN 13 81489074 missense probably damaging 0.98
IGL00508:Adgrv1 APN 13 81506187 missense probably damaging 1.00
IGL00727:Adgrv1 APN 13 81524684 missense probably damaging 0.98
IGL00781:Adgrv1 APN 13 81578230 missense probably benign 0.19
IGL00816:Adgrv1 APN 13 81397203 missense probably benign 0.01
IGL00844:Adgrv1 APN 13 81540119 missense probably damaging 1.00
IGL00923:Adgrv1 APN 13 81382291 missense probably damaging 0.99
IGL01113:Adgrv1 APN 13 81489028 missense probably benign 0.00
IGL01143:Adgrv1 APN 13 81419351 missense probably benign 0.00
IGL01151:Adgrv1 APN 13 81405399 missense probably benign 0.00
IGL01153:Adgrv1 APN 13 81419128 missense probably benign 0.01
IGL01363:Adgrv1 APN 13 81557065 missense probably damaging 1.00
IGL01419:Adgrv1 APN 13 81557158 missense probably damaging 0.99
IGL01545:Adgrv1 APN 13 81466184 missense possibly damaging 0.46
IGL01701:Adgrv1 APN 13 81419631 missense possibly damaging 0.55
IGL01796:Adgrv1 APN 13 81567342 missense probably benign 0.01
IGL01816:Adgrv1 APN 13 81529049 missense probably benign 0.00
IGL01871:Adgrv1 APN 13 81472394 critical splice donor site probably null
IGL01955:Adgrv1 APN 13 81182783 missense probably damaging 1.00
IGL01956:Adgrv1 APN 13 81446430 missense possibly damaging 0.63
IGL01988:Adgrv1 APN 13 81557309 missense probably damaging 0.99
IGL01990:Adgrv1 APN 13 81556996 missense probably damaging 1.00
IGL02007:Adgrv1 APN 13 81568743 splice site probably benign
IGL02016:Adgrv1 APN 13 81397453 missense probably damaging 1.00
IGL02095:Adgrv1 APN 13 81579790 missense possibly damaging 0.63
IGL02174:Adgrv1 APN 13 81427664 missense probably benign 0.34
IGL02270:Adgrv1 APN 13 81559195 unclassified probably null
IGL02328:Adgrv1 APN 13 81578175 missense probably damaging 1.00
IGL02350:Adgrv1 APN 13 81270855 missense probably benign 0.00
IGL02357:Adgrv1 APN 13 81270855 missense probably benign 0.00
IGL02373:Adgrv1 APN 13 81459713 missense possibly damaging 0.90
IGL02402:Adgrv1 APN 13 81559424 missense probably benign 0.18
IGL02407:Adgrv1 APN 13 81479670 missense probably damaging 1.00
IGL02508:Adgrv1 APN 13 81435556
IGL02603:Adgrv1 APN 13 81488952 missense possibly damaging 0.93
IGL02648:Adgrv1 APN 13 81511619 missense probably benign 0.35
IGL02720:Adgrv1 APN 13 81578872 missense probably damaging 0.99
IGL02870:Adgrv1 APN 13 81563732 missense probably benign 0.13
IGL02896:Adgrv1 APN 13 81520739 missense probably damaging 1.00
IGL02931:Adgrv1 APN 13 81579714 missense probably damaging 1.00
IGL02952:Adgrv1 APN 13 81433636 missense probably benign 0.00
IGL02961:Adgrv1 APN 13 81523612 missense probably damaging 1.00
IGL02999:Adgrv1 APN 13 81578854 missense probably benign 0.12
IGL03067:Adgrv1 APN 13 81442480 missense probably damaging 1.00
IGL03106:Adgrv1 APN 13 81472899 missense probably benign 0.00
IGL03108:Adgrv1 APN 13 81559529 missense probably damaging 1.00
IGL03119:Adgrv1 APN 13 81382373 missense probably damaging 1.00
IGL03119:Adgrv1 APN 13 81433700 missense probably benign 0.02
IGL03169:Adgrv1 APN 13 81503900 missense probably damaging 1.00
IGL03186:Adgrv1 APN 13 81433618 missense possibly damaging 0.80
IGL03196:Adgrv1 APN 13 81446478 missense probably benign 0.02
IGL03207:Adgrv1 APN 13 81106898 splice site probably null
IGL03343:Adgrv1 APN 13 81283388 missense probably damaging 1.00
IGL03348:Adgrv1 APN 13 81499058 missense possibly damaging 0.54
IGL03349:Adgrv1 APN 13 81481336 missense probably benign 0.09
IGL03373:Adgrv1 APN 13 81563632 missense probably damaging 0.99
IGL03381:Adgrv1 APN 13 81517967 missense probably damaging 0.99
beatle UTSW 13 81579594 nonsense
Metronome UTSW 13 81435559 critical splice donor site
nome UTSW 13 81391767 missense
F2404:Adgrv1 UTSW 13 81420006 missense probably benign 0.13
I2288:Adgrv1 UTSW 13 81437524 missense probably damaging 1.00
I2289:Adgrv1 UTSW 13 81437524 missense probably damaging 1.00
R0017:Adgrv1 UTSW 13 81578946 missense probably benign 0.13
R0017:Adgrv1 UTSW 13 81578946 missense probably benign 0.13
R0058:Adgrv1 UTSW 13 81182672 missense possibly damaging 0.65
R0058:Adgrv1 UTSW 13 81182672 missense possibly damaging 0.65
R0083:Adgrv1 UTSW 13 81578404 unclassified probably benign
R0087:Adgrv1 UTSW 13 81386951 missense probably damaging 1.00
R0108:Adgrv1 UTSW 13 81578404 unclassified probably benign
R0131:Adgrv1 UTSW 13 81502995 unclassified probably benign
R0218:Adgrv1 UTSW 13 81106898 splice site probably null
R0325:Adgrv1 UTSW 13 81540015 missense probably damaging 1.00
R0326:Adgrv1 UTSW 13 81474993 missense possibly damaging 0.46
R0395:Adgrv1 UTSW 13 81385953 missense probably benign 0.00
R0441:Adgrv1 UTSW 13 81397226 nonsense probably null
R0466:Adgrv1 UTSW 13 81566296 missense probably benign 0.00
R0487:Adgrv1 UTSW 13 81489035 missense probably damaging 1.00
R0501:Adgrv1 UTSW 13 81559150 missense probably damaging 1.00
R0522:Adgrv1 UTSW 13 81528442 splice site probably benign
R0532:Adgrv1 UTSW 13 81578896 missense probably damaging 1.00
R0542:Adgrv1 UTSW 13 81573318 missense probably damaging 1.00
R0681:Adgrv1 UTSW 13 81528530 missense probably damaging 1.00
R0689:Adgrv1 UTSW 13 81475105 missense possibly damaging 0.47
R0732:Adgrv1 UTSW 13 81503004 missense possibly damaging 0.86
R0746:Adgrv1 UTSW 13 81570556 missense probably benign 0.10
R0763:Adgrv1 UTSW 13 81499125 missense probably damaging 0.98
R0846:Adgrv1 UTSW 13 81479742 nonsense probably null
R0962:Adgrv1 UTSW 13 81405346 missense probably benign 0.01
R1146:Adgrv1 UTSW 13 81531676 missense probably damaging 1.00
R1146:Adgrv1 UTSW 13 81531676 missense probably damaging 1.00
R1172:Adgrv1 UTSW 13 81557063 missense probably damaging 0.98
R1178:Adgrv1 UTSW 13 81440037 splice site probably benign
R1310:Adgrv1 UTSW 13 81566377 missense probably benign 0.09
R1386:Adgrv1 UTSW 13 81528865 missense probably benign 0.17
R1387:Adgrv1 UTSW 13 81493176 missense possibly damaging 0.62
R1395:Adgrv1 UTSW 13 81386788 missense probably benign 0.05
R1412:Adgrv1 UTSW 13 81095450 missense probably damaging 1.00
R1448:Adgrv1 UTSW 13 81433513 missense probably benign 0.08
R1470:Adgrv1 UTSW 13 81382298 missense probably benign 0.03
R1470:Adgrv1 UTSW 13 81382298 missense probably benign 0.03
R1485:Adgrv1 UTSW 13 81579619 missense probably damaging 1.00
R1507:Adgrv1 UTSW 13 81472580 critical splice acceptor site probably null
R1513:Adgrv1 UTSW 13 81556957 missense probably damaging 1.00
R1513:Adgrv1 UTSW 13 81593048 missense probably damaging 1.00
R1539:Adgrv1 UTSW 13 81503978 unclassified probably null
R1579:Adgrv1 UTSW 13 81563779 missense probably damaging 1.00
R1580:Adgrv1 UTSW 13 81466160 critical splice donor site probably null
R1611:Adgrv1 UTSW 13 81559117 missense probably damaging 1.00
R1615:Adgrv1 UTSW 13 81424288 missense probably benign 0.41
R1651:Adgrv1 UTSW 13 81487853 missense probably benign 0.19
R1660:Adgrv1 UTSW 13 81476631 missense probably benign 0.00
R1679:Adgrv1 UTSW 13 81559552 missense probably damaging 1.00
R1709:Adgrv1 UTSW 13 81593060 missense probably damaging 1.00
R1735:Adgrv1 UTSW 13 81487947 missense possibly damaging 0.62
R1762:Adgrv1 UTSW 13 81506146 missense probably benign 0.08
R1830:Adgrv1 UTSW 13 81489077 missense possibly damaging 0.65
R1836:Adgrv1 UTSW 13 81504113 missense probably benign 0.01
R1843:Adgrv1 UTSW 13 81544533 missense probably damaging 1.00
R1863:Adgrv1 UTSW 13 81563566 missense probably damaging 1.00
R1895:Adgrv1 UTSW 13 81374249 missense probably damaging 1.00
R1907:Adgrv1 UTSW 13 81592551 splice site probably benign
R1928:Adgrv1 UTSW 13 81520786 missense probably benign 0.00
R1938:Adgrv1 UTSW 13 81391757 missense probably damaging 0.99
R1944:Adgrv1 UTSW 13 81510911 missense probably damaging 1.00
R1946:Adgrv1 UTSW 13 81374249 missense probably damaging 1.00
R1984:Adgrv1 UTSW 13 81523749 missense probably damaging 1.00
R2027:Adgrv1 UTSW 13 81595182 missense probably damaging 1.00
R2063:Adgrv1 UTSW 13 81561469 missense possibly damaging 0.81
R2116:Adgrv1 UTSW 13 81529013 missense probably benign 0.11
R2117:Adgrv1 UTSW 13 81492537 missense probably benign 0.00
R2125:Adgrv1 UTSW 13 81419535 missense probably benign 0.00
R2125:Adgrv1 UTSW 13 81419950 missense probably benign 0.02
R2127:Adgrv1 UTSW 13 81557080 missense probably damaging 1.00
R2128:Adgrv1 UTSW 13 81557080 missense probably damaging 1.00
R2129:Adgrv1 UTSW 13 81557080 missense probably damaging 1.00
R2130:Adgrv1 UTSW 13 81581727 missense possibly damaging 0.61
R2135:Adgrv1 UTSW 13 81524557 critical splice donor site probably null
R2138:Adgrv1 UTSW 13 81445320 missense probably benign 0.00
R2166:Adgrv1 UTSW 13 81568643 missense probably damaging 1.00
R2171:Adgrv1 UTSW 13 81270918 missense probably damaging 1.00
R2191:Adgrv1 UTSW 13 81566290 missense possibly damaging 0.90
R2256:Adgrv1 UTSW 13 81506140 missense probably benign
R2260:Adgrv1 UTSW 13 81568374 missense probably damaging 0.97
R2323:Adgrv1 UTSW 13 81595179 missense probably damaging 1.00
R2432:Adgrv1 UTSW 13 81540132 frame shift probably null
R2910:Adgrv1 UTSW 13 81557119 missense possibly damaging 0.61
R2920:Adgrv1 UTSW 13 81448865 missense probably benign 0.01
R2989:Adgrv1 UTSW 13 81581747 missense probably damaging 1.00
R3402:Adgrv1 UTSW 13 81543542 missense probably damaging 1.00
R3692:Adgrv1 UTSW 13 81524600 missense possibly damaging 0.91
R3711:Adgrv1 UTSW 13 81419475 missense probably benign 0.02
R3732:Adgrv1 UTSW 13 81556956 missense probably damaging 1.00
R3732:Adgrv1 UTSW 13 81556956 missense probably damaging 1.00
R3733:Adgrv1 UTSW 13 81556956 missense probably damaging 1.00
R3773:Adgrv1 UTSW 13 81499043 missense probably damaging 0.98
R3791:Adgrv1 UTSW 13 81593102 missense probably damaging 1.00
R3794:Adgrv1 UTSW 13 81283367 start codon destroyed probably damaging 1.00
R3848:Adgrv1 UTSW 13 81440072 missense probably damaging 0.97
R3880:Adgrv1 UTSW 13 81435705 missense probably benign 0.02
R3925:Adgrv1 UTSW 13 81578772 missense possibly damaging 0.89
R3934:Adgrv1 UTSW 13 81475047 missense probably benign 0.06
R3942:Adgrv1 UTSW 13 81182789 missense probably damaging 1.00
R4002:Adgrv1 UTSW 13 81540132 frame shift probably null
R4003:Adgrv1 UTSW 13 81540132 frame shift probably null
R4194:Adgrv1 UTSW 13 81498996 missense probably damaging 0.98
R4308:Adgrv1 UTSW 13 81440192 missense probably damaging 0.96
R4368:Adgrv1 UTSW 13 81492910 missense unknown
R4388:Adgrv1 UTSW 13 81581709 missense probably damaging 0.98
R4421:Adgrv1 UTSW 13 81566302 missense probably damaging 1.00
R4468:Adgrv1 UTSW 13 81374256 missense probably benign 0.01
R4483:Adgrv1 UTSW 13 81419230 missense probably benign 0.01
R4487:Adgrv1 UTSW 13 81440066 missense probably damaging 0.99
R4566:Adgrv1 UTSW 13 81419808 missense probably damaging 1.00
R4615:Adgrv1 UTSW 13 81494569 splice site probably null
R4647:Adgrv1 UTSW 13 81528795 nonsense probably null
R4657:Adgrv1 UTSW 13 81405364 missense probably benign 0.01
R4723:Adgrv1 UTSW 13 81433525 missense probably benign 0.02
R4765:Adgrv1 UTSW 13 81106919 missense probably damaging 0.99
R4783:Adgrv1 UTSW 13 81095445 missense probably damaging 0.99
R4796:Adgrv1 UTSW 13 81155231 nonsense probably null
R4816:Adgrv1 UTSW 13 81528674 missense probably damaging 1.00
R4833:Adgrv1 UTSW 13 81560844 missense possibly damaging 0.81
R4841:Adgrv1 UTSW 13 81503001 critical splice donor site probably null
R4871:Adgrv1 UTSW 13 81533122 intron probably benign
R4897:Adgrv1 UTSW 13 81561585 splice site probably null
R4906:Adgrv1 UTSW 13 81270738 splice site probably null
R4917:Adgrv1 UTSW 13 81510877 missense probably benign 0.30
R4996:Adgrv1 UTSW 13 81578734 missense probably benign 0.01
R5030:Adgrv1 UTSW 13 81459829 missense probably benign 0.43
R5044:Adgrv1 UTSW 13 81488931 missense probably benign 0.01
R5052:Adgrv1 UTSW 13 81528821 missense probably damaging 0.97
R5093:Adgrv1 UTSW 13 81592585 missense probably damaging 1.00
R5095:Adgrv1 UTSW 13 81095487 missense probably benign 0.00
R5119:Adgrv1 UTSW 13 81419427 missense possibly damaging 0.93
R5133:Adgrv1 UTSW 13 81439441 missense probably damaging 1.00
R5141:Adgrv1 UTSW 13 81270918 missense probably damaging 1.00
R5164:Adgrv1 UTSW 13 81435674 missense probably benign 0.00
R5180:Adgrv1 UTSW 13 81283416 start gained probably benign
R5203:Adgrv1 UTSW 13 81510905 missense possibly damaging 0.91
R5241:Adgrv1 UTSW 13 81488929 nonsense probably null
R5280:Adgrv1 UTSW 13 81397465 missense possibly damaging 0.95
R5289:Adgrv1 UTSW 13 81521084 missense probably benign 0.04
R5304:Adgrv1 UTSW 13 81578253 missense possibly damaging 0.93
R5310:Adgrv1 UTSW 13 81476690 missense possibly damaging 0.95
R5338:Adgrv1 UTSW 13 81529046 missense possibly damaging 0.80
R5352:Adgrv1 UTSW 13 81494657 missense probably damaging 1.00
R5402:Adgrv1 UTSW 13 81459715 missense probably benign 0.25
R5418:Adgrv1 UTSW 13 81419308 missense probably benign 0.01
R5460:Adgrv1 UTSW 13 81424258 missense possibly damaging 0.95
R5510:Adgrv1 UTSW 13 81445244 missense probably damaging 1.00
R5521:Adgrv1 UTSW 13 81419389 missense probably benign 0.01
R5538:Adgrv1 UTSW 13 81433689 missense probably benign 0.02
R5561:Adgrv1 UTSW 13 81476564 missense probably damaging 0.99
R5584:Adgrv1 UTSW 13 81405267 missense probably damaging 1.00
R5608:Adgrv1 UTSW 13 81155276 missense probably damaging 1.00
R5610:Adgrv1 UTSW 13 81521117 missense probably damaging 1.00
R5619:Adgrv1 UTSW 13 81472500 missense probably damaging 1.00
R5751:Adgrv1 UTSW 13 81522236 missense probably damaging 1.00
R5832:Adgrv1 UTSW 13 81103302 missense possibly damaging 0.95
R5885:Adgrv1 UTSW 13 81424271 missense probably benign 0.15
R5930:Adgrv1 UTSW 13 81397451 missense probably benign 0.06
R5937:Adgrv1 UTSW 13 81107075 missense probably damaging 0.96
R5943:Adgrv1 UTSW 13 81386866 missense probably damaging 0.98
R5951:Adgrv1 UTSW 13 81442501 missense probably damaging 1.00
R5977:Adgrv1 UTSW 13 81435559 critical splice donor site probably null
R5995:Adgrv1 UTSW 13 81466259 missense probably benign 0.03
R6017:Adgrv1 UTSW 13 81397423 nonsense probably null
R6024:Adgrv1 UTSW 13 81476505 missense probably benign 0.26
R6049:Adgrv1 UTSW 13 81397354 missense probably benign 0.00
R6108:Adgrv1 UTSW 13 81391695 missense probably damaging 0.99
R6130:Adgrv1 UTSW 13 81427745 missense probably damaging 0.99
R6132:Adgrv1 UTSW 13 81506076 missense probably benign 0.04
R6149:Adgrv1 UTSW 13 81182774 missense probably damaging 1.00
R6169:Adgrv1 UTSW 13 81419259 missense probably benign 0.00
R6175:Adgrv1 UTSW 13 81386005 missense probably damaging 1.00
R6184:Adgrv1 UTSW 13 81433838 missense probably benign 0.01
R6190:Adgrv1 UTSW 13 81524779 splice site probably null
R6215:Adgrv1 UTSW 13 81579594 nonsense probably null
R6216:Adgrv1 UTSW 13 81524471 intron probably null
R6238:Adgrv1 UTSW 13 81466283 missense probably benign 0.07
R6244:Adgrv1 UTSW 13 81106931 missense probably damaging 1.00
R6298:Adgrv1 UTSW 13 81391767 missense probably benign 0.00
R6316:Adgrv1 UTSW 13 81499068 missense possibly damaging 0.63
R6336:Adgrv1 UTSW 13 81385981 missense probably benign 0.09
R6358:Adgrv1 UTSW 13 81414583 missense probably damaging 0.99
R6421:Adgrv1 UTSW 13 81508736 missense possibly damaging 0.69
R6466:Adgrv1 UTSW 13 81575101 unclassified probably null
R6467:Adgrv1 UTSW 13 81444538 missense probably benign 0.01
R6510:Adgrv1 UTSW 13 81559490 missense possibly damaging 0.88
R6519:Adgrv1 UTSW 13 81567343 missense probably benign 0.01
R6521:Adgrv1 UTSW 13 81433652 missense probably damaging 1.00
R6598:Adgrv1 UTSW 13 81506179 missense probably damaging 1.00
R6605:Adgrv1 UTSW 13 81487962 missense possibly damaging 0.80
R6626:Adgrv1 UTSW 13 81518126 missense probably damaging 1.00
R6633:Adgrv1 UTSW 13 81568643 missense probably damaging 1.00
R6721:Adgrv1 UTSW 13 81481515 missense probably benign 0.00
R6725:Adgrv1 UTSW 13 81437557 missense probably damaging 0.99
R6725:Adgrv1 UTSW 13 81493210 missense probably damaging 1.00
R6796:Adgrv1 UTSW 13 81472478 missense probably damaging 1.00
R6809:Adgrv1 UTSW 13 81472953 missense probably benign 0.01
R6823:Adgrv1 UTSW 13 81557081 missense probably damaging 1.00
R6876:Adgrv1 UTSW 13 81155154 critical splice donor site probably null
R6878:Adgrv1 UTSW 13 81433494 missense probably benign 0.06
R6887:Adgrv1 UTSW 13 81528701 missense probably benign 0.01
R6888:Adgrv1 UTSW 13 81508669 missense probably damaging 1.00
R6957:Adgrv1 UTSW 13 81567490 missense probably benign 0.00
R6976:Adgrv1 UTSW 13 81520997 missense probably damaging 1.00
X0054:Adgrv1 UTSW 13 81559270 missense probably damaging 1.00
X0062:Adgrv1 UTSW 13 81386926 missense probably damaging 0.99
X0067:Adgrv1 UTSW 13 81543392 missense possibly damaging 0.51
Z1088:Adgrv1 UTSW 13 81476672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGAGCATGTGAAATCATAAGC -3'
(R):5'- TCACAACCCAGTAAGATTATTTCTCCC -3'

Sequencing Primer
(F):5'- TAAGCAATACCTCAAGGCTCGGTG -3'
(R):5'- TTCAAATGCTATCCCGAAAGTTCC -3'
Posted On2018-02-27