Incidental Mutation 'R6191:Dock2'
ID502574
Institutional Source Beutler Lab
Gene Symbol Dock2
Ensembl Gene ENSMUSG00000020143
Gene Namededicator of cyto-kinesis 2
SynonymsCED-5, MBC, Hch
MMRRC Submission 044331-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6191 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location34226815-34783892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34231652 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1637 (R1637H)
Ref Sequence ENSEMBL: ENSMUSP00000090884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093193]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093193
AA Change: R1637H

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143
AA Change: R1637H

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127846
Meta Mutation Damage Score 0.264 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic cells and is predominantly expressed in peripheral blood leukocytes. The protein is involved in remodeling of the actin cytoskeleton required for lymphocyte migration in response to chemokine signaling. It activates members of the Rho family of GTPases, for example RAC1 and RAC2, by acting as a guanine nucleotide exchange factor (GEF) to exchange bound GDP for free GTP. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A C 9: 56,002,523 D144E possibly damaging Het
Amigo2 T A 15: 97,245,538 K334N probably benign Het
Ano6 T C 15: 95,948,499 probably null Het
Ap1m2 C A 9: 21,299,305 V343F probably benign Het
Apol6 T C 15: 77,055,898 V307A probably benign Het
Arsi C A 18: 60,912,472 A78E probably damaging Het
B2m A T 2: 122,150,915 N37I possibly damaging Het
C8a T C 4: 104,845,903 K363R probably benign Het
Ccdc117 C A 11: 5,534,242 probably null Het
Ccdc154 C A 17: 25,167,971 Q325K probably damaging Het
Cd300e A T 11: 115,054,533 V145E possibly damaging Het
Col19a1 G T 1: 24,317,393 P673Q probably damaging Het
Csn2 A G 5: 87,696,026 probably null Het
Ctnna1 T C 18: 35,174,355 V135A probably damaging Het
Dnah11 T A 12: 118,190,897 D216V probably benign Het
Dnah12 A G 14: 26,710,257 H410R probably benign Het
Dspp A G 5: 104,177,348 N526D unknown Het
Frem2 T C 3: 53,655,280 H602R probably benign Het
Galc A T 12: 98,252,034 H186Q probably damaging Het
Grina T C 15: 76,249,018 V262A probably damaging Het
Gse1 G A 8: 120,553,803 probably null Het
H2-Oa C A 17: 34,093,868 Q40K probably damaging Het
Hfm1 C A 5: 106,886,553 D763Y possibly damaging Het
Hmcn2 T A 2: 31,458,746 Y4925N probably damaging Het
Hs3st3b1 C A 11: 63,889,203 R366L probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Itpr2 A G 6: 146,328,335 V1221A probably benign Het
K230010J24Rik T C 15: 76,046,369 probably null Het
Kdm6b T C 11: 69,406,758 N285S probably benign Het
Klk1b1 T A 7: 43,970,657 N181K probably damaging Het
Kmt2a C A 9: 44,826,828 probably benign Het
Lama5 T A 2: 180,180,611 T2890S probably damaging Het
Lama5 T C 2: 180,185,959 D2170G probably damaging Het
Lsm2 T A 17: 34,982,155 probably benign Het
Map3k5 G T 10: 20,023,669 C232F probably damaging Het
Mapk9 T G 11: 49,863,556 D45E probably damaging Het
Mpnd T C 17: 56,012,482 V315A possibly damaging Het
Msh2 A G 17: 87,723,472 I926V probably benign Het
Mtcl1 C T 17: 66,343,526 R1345H probably damaging Het
Nbeal2 A G 9: 110,627,990 probably null Het
Neo1 T C 9: 58,889,029 D1205G probably damaging Het
Nhlrc2 A G 19: 56,570,859 S259G probably benign Het
Nkain4 G A 2: 180,936,003 P186L probably damaging Het
Nkain4 G A 2: 180,936,004 P186S probably damaging Het
Nlrp1b T A 11: 71,218,457 R73* probably null Het
Nr5a2 T C 1: 136,890,798 D330G probably damaging Het
Nup54 A G 5: 92,424,294 L299P probably damaging Het
Olfr259 A G 2: 87,107,952 V145A probably damaging Het
Olfr56 T C 11: 49,135,050 L286P probably damaging Het
Pcdhb8 T A 18: 37,356,226 V319E probably benign Het
Pcsk6 T A 7: 65,929,127 D129E probably benign Het
Pld5 G A 1: 175,970,534 T433I probably benign Het
Plin1 A T 7: 79,721,599 L459H probably benign Het
Psd4 T C 2: 24,394,487 V121A probably damaging Het
Pxdn A T 12: 29,982,717 I167F possibly damaging Het
R3hdm2 T C 10: 127,484,515 S569P probably damaging Het
Rfng T A 11: 120,782,690 T202S probably damaging Het
Robo1 T C 16: 72,933,808 S266P probably benign Het
Sema3c G T 5: 17,653,806 V68L probably damaging Het
Slco6c1 C T 1: 97,066,083 R645H possibly damaging Het
Slfn8 A G 11: 83,016,800 Y306H possibly damaging Het
Snap91 T C 9: 86,838,052 D144G probably damaging Het
St7l T G 3: 104,868,033 F75C probably damaging Het
Stard10 A G 7: 101,343,261 I145V probably damaging Het
Tekt3 C T 11: 63,078,173 A242V probably damaging Het
Tex44 A G 1: 86,426,584 probably benign Het
Thg1l T C 11: 45,954,161 Q88R probably benign Het
Trav8n-2 T A 14: 53,346,287 I67N probably damaging Het
Ttn G A 2: 76,847,426 probably benign Het
Ube4a A T 9: 44,949,753 L253* probably null Het
Uggt1 A T 1: 36,162,208 N1150K probably damaging Het
Uhrf1bp1l G T 10: 89,805,318 G784C possibly damaging Het
Ush2a T A 1: 188,263,101 L23* probably null Het
Usp22 T A 11: 61,174,776 N37I probably benign Het
Usp53 T A 3: 122,949,741 K515N probably damaging Het
Vmn2r4 T C 3: 64,415,281 K6E probably benign Het
Vps13d C T 4: 145,149,348 V1530M probably damaging Het
Vwa3b A G 1: 37,114,531 I485V possibly damaging Het
Wnk4 T C 11: 101,264,330 Y356H probably damaging Het
Zcchc2 A G 1: 105,990,170 probably benign Het
Zfp345 A C 2: 150,473,090 Y176D probably benign Het
Zfp598 T C 17: 24,677,876 F238S possibly damaging Het
Zkscan17 T C 11: 59,502,994 D10G probably damaging Het
Zmat4 T G 8: 23,902,067 M13R probably damaging Het
Other mutations in Dock2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dock2 APN 11 34704661 missense probably damaging 1.00
IGL00469:Dock2 APN 11 34229603 splice site probably benign
IGL01061:Dock2 APN 11 34705826 missense probably damaging 1.00
IGL01319:Dock2 APN 11 34698790 missense possibly damaging 0.61
IGL01451:Dock2 APN 11 34310390 missense probably damaging 1.00
IGL01490:Dock2 APN 11 34705781 missense probably damaging 0.97
IGL01601:Dock2 APN 11 34239528 critical splice donor site probably null
IGL01800:Dock2 APN 11 34756273 missense probably damaging 1.00
IGL01804:Dock2 APN 11 34262433 missense probably benign 0.01
IGL01823:Dock2 APN 11 34262391 missense probably damaging 1.00
IGL01829:Dock2 APN 11 34705841 missense probably damaging 0.98
IGL01830:Dock2 APN 11 34691917 nonsense probably null
IGL01835:Dock2 APN 11 34310435 missense possibly damaging 0.51
IGL01845:Dock2 APN 11 34708865 missense probably benign 0.02
IGL01953:Dock2 APN 11 34732356 missense probably benign 0.28
IGL01989:Dock2 APN 11 34268053 missense probably benign
IGL02081:Dock2 APN 11 34254355 missense probably benign
IGL02105:Dock2 APN 11 34714525 missense probably damaging 1.00
IGL02153:Dock2 APN 11 34230670 missense probably benign 0.01
IGL02170:Dock2 APN 11 34267949 missense probably damaging 1.00
IGL02344:Dock2 APN 11 34731510 missense probably damaging 0.98
IGL02389:Dock2 APN 11 34698740 splice site probably benign
IGL02409:Dock2 APN 11 34501204 missense probably benign 0.00
IGL02472:Dock2 APN 11 34249801 missense probably benign 0.00
IGL02625:Dock2 APN 11 34501168 critical splice donor site probably null
IGL02929:Dock2 APN 11 34268048 missense probably damaging 1.00
IGL02951:Dock2 APN 11 34310448 unclassified probably benign
IGL02999:Dock2 APN 11 34692259 missense probably damaging 0.99
IGL03165:Dock2 APN 11 34687533 missense probably damaging 0.99
Arches UTSW 11 34689760 missense probably damaging 1.00
capitol_reef UTSW 11 34294170 critical splice acceptor site probably null
denali UTSW 11 34229472 critical splice donor site probably null
dew UTSW 11 34248636 nonsense probably null
Dry UTSW 11 34231652 missense possibly damaging 0.79
frazz UTSW 11 34248572 critical splice donor site probably benign
frizz UTSW 11 34258184 splice site probably benign
Harborside UTSW 11 34262445 missense probably benign
Landing UTSW 11 34714501 missense possibly damaging 0.83
latest UTSW 11 34756222 missense probably damaging 1.00
Launch UTSW 11 34256562 missense probably damaging 1.00
liaoning UTSW 11 34708793 missense probably damaging 1.00
midas UTSW 11 34294323 missense probably damaging 0.99
muelle UTSW 11 34687538 missense probably damaging 1.00
pier UTSW 11 34689766 missense probably damaging 1.00
plank UTSW 11 34783795 missense possibly damaging 0.51
riches UTSW 11 34688452 critical splice donor site probably null
skiff UTSW 11 34262388 missense probably null 0.80
Slip UTSW 11 34294286 missense probably benign 0.25
wassup UTSW 11 34503413 missense probably damaging 1.00
Wharf UTSW 11 34732371 missense possibly damaging 0.81
IGL03052:Dock2 UTSW 11 34232853 missense probably benign 0.01
PIT4377001:Dock2 UTSW 11 34721008 missense probably benign 0.02
R0006:Dock2 UTSW 11 34312453 unclassified probably benign
R0012:Dock2 UTSW 11 34783795 missense possibly damaging 0.51
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0116:Dock2 UTSW 11 34688565 intron probably benign
R0149:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0361:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0462:Dock2 UTSW 11 34268052 missense possibly damaging 0.74
R0471:Dock2 UTSW 11 34688553 missense probably benign 0.30
R0538:Dock2 UTSW 11 34704718 splice site probably benign
R0543:Dock2 UTSW 11 34294325 missense probably damaging 1.00
R0660:Dock2 UTSW 11 34248621 missense probably damaging 1.00
R0676:Dock2 UTSW 11 34695236 missense probably damaging 0.99
R0722:Dock2 UTSW 11 34464970 splice site probably benign
R0801:Dock2 UTSW 11 34708793 missense probably damaging 1.00
R1110:Dock2 UTSW 11 34256535 missense possibly damaging 0.78
R1171:Dock2 UTSW 11 34695241 missense probably damaging 1.00
R1387:Dock2 UTSW 11 34273309 splice site probably benign
R1445:Dock2 UTSW 11 34239705 missense probably benign
R1494:Dock2 UTSW 11 34282761 nonsense probably null
R1589:Dock2 UTSW 11 34706461 missense probably damaging 0.99
R1597:Dock2 UTSW 11 34704647 missense probably benign 0.00
R1629:Dock2 UTSW 11 34262480 splice site probably null
R1749:Dock2 UTSW 11 34232767 critical splice donor site probably null
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1899:Dock2 UTSW 11 34294286 missense probably benign 0.25
R1924:Dock2 UTSW 11 34464934 missense possibly damaging 0.69
R2031:Dock2 UTSW 11 34727470 splice site probably benign
R2045:Dock2 UTSW 11 34294106 splice site probably null
R2098:Dock2 UTSW 11 34266279 missense probably benign 0.16
R2098:Dock2 UTSW 11 34719005 missense probably damaging 0.99
R2129:Dock2 UTSW 11 34727415 missense probably damaging 1.00
R2147:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2149:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2150:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2176:Dock2 UTSW 11 34695217 missense probably benign 0.00
R2230:Dock2 UTSW 11 34294323 missense probably damaging 0.99
R2508:Dock2 UTSW 11 34312485 missense probably benign 0.04
R2875:Dock2 UTSW 11 34718885 missense probably damaging 1.00
R2885:Dock2 UTSW 11 34689766 missense probably damaging 1.00
R2910:Dock2 UTSW 11 34232910 splice site probably benign
R3081:Dock2 UTSW 11 34231610 missense probably benign
R3418:Dock2 UTSW 11 34689760 missense probably damaging 1.00
R3552:Dock2 UTSW 11 34720960 missense probably benign 0.22
R3731:Dock2 UTSW 11 34708895 missense probably damaging 1.00
R3846:Dock2 UTSW 11 34732371 missense possibly damaging 0.81
R4135:Dock2 UTSW 11 34714501 missense possibly damaging 0.83
R4598:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4599:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4715:Dock2 UTSW 11 34294118 missense probably damaging 1.00
R4722:Dock2 UTSW 11 34695471 missense probably damaging 1.00
R4742:Dock2 UTSW 11 34294170 critical splice acceptor site probably null
R4830:Dock2 UTSW 11 34273767 splice site probably null
R4884:Dock2 UTSW 11 34266248 missense probably damaging 1.00
R4990:Dock2 UTSW 11 34695251 missense probably damaging 1.00
R5334:Dock2 UTSW 11 34228643 missense probably benign 0.00
R5570:Dock2 UTSW 11 34727406 missense probably damaging 1.00
R5602:Dock2 UTSW 11 34254391 missense probably benign 0.16
R5681:Dock2 UTSW 11 34249836 missense probably benign 0.06
R5809:Dock2 UTSW 11 34262445 missense probably benign
R5860:Dock2 UTSW 11 34256562 missense probably damaging 1.00
R6111:Dock2 UTSW 11 34708787 missense probably damaging 0.99
R6155:Dock2 UTSW 11 34294123 missense probably benign 0.06
R6156:Dock2 UTSW 11 34247789 missense possibly damaging 0.51
R6173:Dock2 UTSW 11 34262388 missense probably null 0.80
R6182:Dock2 UTSW 11 34229476 missense probably damaging 0.97
R6188:Dock2 UTSW 11 34503396 missense probably damaging 0.98
R6283:Dock2 UTSW 11 34707325 missense probably damaging 0.99
R6395:Dock2 UTSW 11 34232874 missense probably damaging 1.00
R6465:Dock2 UTSW 11 34503413 missense probably damaging 1.00
R6500:Dock2 UTSW 11 34362822 missense possibly damaging 0.76
R6561:Dock2 UTSW 11 34687538 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705842 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705843 missense probably damaging 1.00
R6880:Dock2 UTSW 11 34688452 critical splice donor site probably null
R6913:Dock2 UTSW 11 34756222 missense probably damaging 1.00
R6997:Dock2 UTSW 11 34464922 missense probably damaging 1.00
R7057:Dock2 UTSW 11 34227684 missense probably benign 0.10
R7057:Dock2 UTSW 11 34695217 missense probably benign 0.00
R7134:Dock2 UTSW 11 34310363 missense probably benign 0.03
R7188:Dock2 UTSW 11 34239675 missense possibly damaging 0.87
R7239:Dock2 UTSW 11 34231677 missense probably benign 0.00
R7247:Dock2 UTSW 11 34714513 nonsense probably null
R7250:Dock2 UTSW 11 34695205 missense probably benign 0.01
R7250:Dock2 UTSW 11 34695293 missense probably damaging 1.00
R7271:Dock2 UTSW 11 34273750 missense possibly damaging 0.95
R7284:Dock2 UTSW 11 34230672 missense probably benign 0.01
X0017:Dock2 UTSW 11 34266271 missense probably benign 0.08
X0018:Dock2 UTSW 11 34232833 missense possibly damaging 0.65
X0058:Dock2 UTSW 11 34256564 missense probably damaging 1.00
X0066:Dock2 UTSW 11 34310357 missense possibly damaging 0.95
Z1088:Dock2 UTSW 11 34438300 missense probably benign 0.14
Z1088:Dock2 UTSW 11 34692382 missense probably damaging 1.00
Z1088:Dock2 UTSW 11 34695212 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCTGCTGTCCAGGATGC -3'
(R):5'- TGCTGGTGTCTATCCTGCAG -3'

Sequencing Primer
(F):5'- TCAAGGCAACATGCTGCATG -3'
(R):5'- AGCCCTGTGGTCTTGCTGAC -3'
Posted On2018-02-27