Incidental Mutation 'R6192:Col4a4'
ID502610
Institutional Source Beutler Lab
Gene Symbol Col4a4
Ensembl Gene ENSMUSG00000067158
Gene Namecollagen, type IV, alpha 4
SynonymsE130010M05Rik, [a]4(IV)
MMRRC Submission
Accession Numbers

Genbank: NM_007735; MGI: 104687

Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R6192 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location82448423-82586849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 82484430 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 1075 (P1075T)
Ref Sequence ENSEMBL: ENSMUSP00000084282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087050]
Predicted Effect probably damaging
Transcript: ENSMUST00000087050
AA Change: P1075T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084282
Gene: ENSMUSG00000067158
AA Change: P1075T

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
Pfam:Collagen 54 113 4e-11 PFAM
Pfam:Collagen 110 168 4.1e-10 PFAM
Pfam:Collagen 172 229 2.8e-10 PFAM
low complexity region 265 288 N/A INTRINSIC
internal_repeat_7 289 345 1.46e-9 PROSPERO
internal_repeat_6 291 348 5.03e-10 PROSPERO
internal_repeat_9 297 353 7.22e-9 PROSPERO
internal_repeat_4 322 354 2.06e-11 PROSPERO
internal_repeat_11 334 349 1.25e-5 PROSPERO
Pfam:Collagen 392 449 1.3e-8 PFAM
low complexity region 461 482 N/A INTRINSIC
Pfam:Collagen 486 553 1e-10 PFAM
low complexity region 563 595 N/A INTRINSIC
Pfam:Collagen 597 658 1e-8 PFAM
Pfam:Collagen 663 731 4.4e-10 PFAM
Pfam:Collagen 755 810 3.3e-9 PFAM
internal_repeat_2 816 841 2.9e-13 PROSPERO
Pfam:Collagen 844 912 1.8e-10 PFAM
Pfam:Collagen 898 962 2.7e-10 PFAM
low complexity region 963 1003 N/A INTRINSIC
Pfam:Collagen 1006 1071 2e-10 PFAM
Pfam:Collagen 1073 1132 5.8e-12 PFAM
Pfam:Collagen 1124 1185 1.8e-10 PFAM
Pfam:Collagen 1187 1245 2.3e-8 PFAM
low complexity region 1277 1361 N/A INTRINSIC
low complexity region 1371 1384 N/A INTRINSIC
Pfam:Collagen 1395 1454 4.3e-8 PFAM
C4 1457 1564 3.36e-58 SMART
C4 1565 1681 1.49e-59 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced mutation develop an early nephritic syndrome associated with uremia, proteinuria, hematuria, leukocyturia, and focal segmental glomerulosclerosis, and die prematurely of kidney failure. Some homozygotes exhibit moderatesensorineural hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,988,169 T2768I probably benign Het
Adamts9 T C 6: 92,797,021 E1137G probably damaging Het
Adcy9 T C 16: 4,287,954 I1099V probably benign Het
Angptl4 A T 17: 33,777,041 N320K probably benign Het
Atp6v0a2 G A 5: 124,629,203 M10I probably benign Het
Cbfa2t3 A G 8: 122,634,396 S395P probably benign Het
Cenpe C T 3: 135,248,530 T1716I possibly damaging Het
Chsy1 T C 7: 66,170,877 Y287H probably benign Het
Cryab T A 9: 50,754,513 M68K probably damaging Het
Cybrd1 T A 2: 71,137,514 L143Q probably null Het
Dcaf7 T C 11: 106,051,758 V177A probably damaging Het
Dclk2 T C 3: 86,815,150 Y392C probably damaging Het
Ddx20 T C 3: 105,678,720 T770A probably benign Het
Dennd1b T A 1: 139,167,718 D501E probably benign Het
Dgkh A T 14: 78,628,064 Y26* probably null Het
Dnajc2 A G 5: 21,768,648 V196A probably damaging Het
Etl4 A G 2: 20,801,551 K827E probably damaging Het
Fam8a1 C T 13: 46,669,623 P13L probably damaging Het
Gfra3 T C 18: 34,704,529 S139G possibly damaging Het
Ggnbp1 G A 17: 27,029,873 V139I possibly damaging Het
Gja1 T A 10: 56,388,234 Y230N probably damaging Het
Gldc A G 19: 30,133,772 S535P probably damaging Het
Gm45871 A G 18: 90,592,233 T532A probably benign Het
Gm5431 T A 11: 48,894,393 D107V probably benign Het
Herc2 C T 7: 56,207,762 T4031M probably damaging Het
Iffo2 G A 4: 139,606,458 A282T probably damaging Het
Ifi44 T G 3: 151,745,639 probably null Het
Igkv4-53 C T 6: 69,648,931 R62H possibly damaging Het
Lrp11 A C 10: 7,598,690 probably null Het
Lrp4 A G 2: 91,508,488 T1755A probably benign Het
Mcm3ap A T 10: 76,501,100 K1316M probably damaging Het
Mctp1 T G 13: 76,822,963 probably null Het
Mroh5 A T 15: 73,790,781 I396N probably damaging Het
Mrps5 T A 2: 127,601,385 H294Q probably damaging Het
Muc16 A T 9: 18,658,689 S845T unknown Het
Mycbpap A T 11: 94,507,731 V474E probably damaging Het
Mzt2 G C 16: 15,848,687 S122W probably benign Het
Neb T C 2: 52,256,790 I2821V probably benign Het
Ngef A T 1: 87,487,900 D347E probably damaging Het
Nlrp14 T C 7: 107,182,439 V281A probably benign Het
Obscn A T 11: 58,998,038 Y7597N unknown Het
Olfr1297 T C 2: 111,621,175 R300G possibly damaging Het
Patj G T 4: 98,456,157 G569W probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Phf2 T A 13: 48,820,107 T361S unknown Het
Pik3r6 A G 11: 68,543,629 E552G probably damaging Het
Pitx2 A G 3: 129,215,872 T147A probably benign Het
Pkmyt1 G A 17: 23,734,193 G241D probably damaging Het
Pola2 A T 19: 5,953,774 V191D possibly damaging Het
Ralgapb T A 2: 158,449,447 probably null Het
Rapgef4 T C 2: 71,981,317 S11P probably benign Het
Rnf10 G A 5: 115,257,077 R151C probably damaging Het
Rpl34 G A 3: 130,729,067 P50L probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sbno2 A T 10: 80,060,016 L977Q probably damaging Het
Sec14l3 G A 11: 4,075,566 probably null Het
Serping1 A T 2: 84,770,268 N243K possibly damaging Het
Slco2b1 T A 7: 99,685,572 I231F probably damaging Het
Spag8 A G 4: 43,652,458 F294S probably damaging Het
Speer4f1 G A 5: 17,479,495 A174T probably damaging Het
Spred3 T C 7: 29,162,977 D147G probably benign Het
Stard9 A G 2: 120,696,760 D1166G probably damaging Het
Svep1 G T 4: 58,104,536 T1229K possibly damaging Het
Tanc1 T A 2: 59,838,961 probably null Het
Tmem232 T C 17: 65,430,805 Y420C probably damaging Het
Tubd1 A T 11: 86,557,793 M311L probably benign Het
Tulp3 G A 6: 128,355,740 probably null Het
Usp42 T C 5: 143,717,187 T560A possibly damaging Het
Vmn1r170 A T 7: 23,606,509 Y112F probably damaging Het
Vmn2r4 A T 3: 64,415,278 C7S probably benign Het
Wrn A G 8: 33,284,654 M652T probably benign Het
Wsb1 G A 11: 79,248,510 P120L possibly damaging Het
Zfp142 T C 1: 74,570,508 E1376G probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Col4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col4a4 APN 1 82491641 missense unknown
IGL01092:Col4a4 APN 1 82466545 missense unknown
IGL01104:Col4a4 APN 1 82466545 missense unknown
IGL01413:Col4a4 APN 1 82471248 missense unknown
IGL01518:Col4a4 APN 1 82455759 missense unknown
IGL02014:Col4a4 APN 1 82523960 splice site probably benign
IGL02215:Col4a4 APN 1 82453809 missense unknown
IGL02707:Col4a4 APN 1 82493516 missense unknown
IGL02858:Col4a4 APN 1 82528483 missense unknown
IGL02987:Col4a4 APN 1 82498925 splice site probably benign
IGL03384:Col4a4 APN 1 82484438 missense probably benign 0.04
aoba UTSW 1 82535740 critical splice donor site probably benign
IGL02980:Col4a4 UTSW 1 82469477 critical splice donor site probably null
R0028:Col4a4 UTSW 1 82487510 critical splice donor site probably null
R0083:Col4a4 UTSW 1 82507111 critical splice acceptor site probably null
R0696:Col4a4 UTSW 1 82492549 missense unknown
R0788:Col4a4 UTSW 1 82524996 missense unknown
R0789:Col4a4 UTSW 1 82524996 missense unknown
R0790:Col4a4 UTSW 1 82524996 missense unknown
R0894:Col4a4 UTSW 1 82529656 splice site probably null
R1217:Col4a4 UTSW 1 82489009 critical splice donor site probably null
R1465:Col4a4 UTSW 1 82497822 splice site probably null
R1465:Col4a4 UTSW 1 82497822 splice site probably null
R1474:Col4a4 UTSW 1 82480486 nonsense probably null
R1508:Col4a4 UTSW 1 82455836 missense unknown
R1640:Col4a4 UTSW 1 82535770 missense unknown
R1678:Col4a4 UTSW 1 82486659 missense unknown
R1827:Col4a4 UTSW 1 82539988 missense unknown
R1930:Col4a4 UTSW 1 82466600 splice site probably null
R1931:Col4a4 UTSW 1 82466600 splice site probably null
R2092:Col4a4 UTSW 1 82498946 missense unknown
R2122:Col4a4 UTSW 1 82456871 missense unknown
R2132:Col4a4 UTSW 1 82497860 missense unknown
R2396:Col4a4 UTSW 1 82507072 missense unknown
R2418:Col4a4 UTSW 1 82532936 missense unknown
R2679:Col4a4 UTSW 1 82529611 missense unknown
R3085:Col4a4 UTSW 1 82529564 critical splice donor site probably null
R3437:Col4a4 UTSW 1 82497168 missense unknown
R3697:Col4a4 UTSW 1 82541237 missense unknown
R3730:Col4a4 UTSW 1 82455751 synonymous probably null
R3752:Col4a4 UTSW 1 82480494 missense probably damaging 0.97
R4085:Col4a4 UTSW 1 82471188 critical splice donor site probably null
R4087:Col4a4 UTSW 1 82523922 missense unknown
R4088:Col4a4 UTSW 1 82523922 missense unknown
R4090:Col4a4 UTSW 1 82523922 missense unknown
R4213:Col4a4 UTSW 1 82453144 missense unknown
R4422:Col4a4 UTSW 1 82489838 missense unknown
R4596:Col4a4 UTSW 1 82471219 missense unknown
R4755:Col4a4 UTSW 1 82541174 missense unknown
R4757:Col4a4 UTSW 1 82528466 missense unknown
R4793:Col4a4 UTSW 1 82539099 missense unknown
R4812:Col4a4 UTSW 1 82462153 missense unknown
R4833:Col4a4 UTSW 1 82529602 missense unknown
R5259:Col4a4 UTSW 1 82453893 missense unknown
R5264:Col4a4 UTSW 1 82493591 missense unknown
R5265:Col4a4 UTSW 1 82493591 missense unknown
R5281:Col4a4 UTSW 1 82493591 missense unknown
R5283:Col4a4 UTSW 1 82493591 missense unknown
R5284:Col4a4 UTSW 1 82493591 missense unknown
R5387:Col4a4 UTSW 1 82493591 missense unknown
R5388:Col4a4 UTSW 1 82493591 missense unknown
R5435:Col4a4 UTSW 1 82454007 missense unknown
R5534:Col4a4 UTSW 1 82487517 missense unknown
R5666:Col4a4 UTSW 1 82485579 critical splice donor site probably null
R5670:Col4a4 UTSW 1 82485579 critical splice donor site probably null
R5943:Col4a4 UTSW 1 82525016 missense unknown
R5996:Col4a4 UTSW 1 82455728 missense unknown
R5999:Col4a4 UTSW 1 82492619 missense unknown
R6112:Col4a4 UTSW 1 82453883 missense unknown
R6237:Col4a4 UTSW 1 82507031 missense unknown
R6419:Col4a4 UTSW 1 82466486 critical splice donor site probably null
R6458:Col4a4 UTSW 1 82455825 missense unknown
R6460:Col4a4 UTSW 1 82466532 missense unknown
R6481:Col4a4 UTSW 1 82453778 missense unknown
R6522:Col4a4 UTSW 1 82487583 missense unknown
X0020:Col4a4 UTSW 1 82539952 critical splice donor site probably null
Z1088:Col4a4 UTSW 1 82453196 missense unknown
Predicted Primers PCR Primer
(F):5'- GTACACACCTGAATGGGCAAATG -3'
(R):5'- ATGGTACACTTACACACATGTGAG -3'

Sequencing Primer
(F):5'- CACACCTGAATGGGCAAATGGTAAAG -3'
(R):5'- TGTATTTCCATTGTCCTTCTTTGTG -3'
Posted On2018-02-27