Incidental Mutation 'R6193:Pla2g4a'
ID502689
Institutional Source Beutler Lab
Gene Symbol Pla2g4a
Ensembl Gene ENSMUSG00000056220
Gene Namephospholipase A2, group IVA (cytosolic, calcium-dependent)
SynonymsType IV PLA2, cytosolic phospholipase A2, Pla2g4, cytosolic PLA2, cPLA2alpha, cPLA2
MMRRC Submission 044333-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R6193 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location149829618-149961290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 149902430 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 5 (D5G)
Ref Sequence ENSEMBL: ENSMUSP00000139851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070200] [ENSMUST00000111926] [ENSMUST00000190507]
Predicted Effect probably damaging
Transcript: ENSMUST00000070200
AA Change: D43G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070868
Gene: ENSMUSG00000056220
AA Change: D43G

DomainStartEndE-ValueType
C2 19 121 8.23e-17 SMART
PLAc 117 668 N/A SMART
Blast:PLAc 706 748 3e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111926
AA Change: D35G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107557
Gene: ENSMUSG00000056220
AA Change: D35G

DomainStartEndE-ValueType
C2 11 113 8.23e-17 SMART
PLAc 109 660 N/A SMART
Blast:PLAc 698 740 3e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155438
Predicted Effect probably damaging
Transcript: ENSMUST00000190507
AA Change: D5G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139851
Gene: ENSMUSG00000056220
AA Change: D5G

DomainStartEndE-ValueType
C2 5 83 7.1e-10 SMART
Blast:PLAc 89 149 5e-32 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the phospholipase A2 group IV family. This enzyme hydrolyzes membrane phospholipids, thereby releasing the polyunsaturated fatty acid, arachidonic acid. Arachidonic acid is further metabolized into eicosanoids such as leukotrienes, thromboxanes and prostaglandins, that play important roles in regulating diverse biological processes such as inflammatory responses, membrane and actin dynamics, and tumorigenesis. A rise in intracellular calcium levels results in binding of calcium to the C2 domain of this protein, and triggers the translocation from the cytosol to intracellular membranes, including the Golgi apparatus. Disruption of this gene in mice led to decreased levels of eicosonaoids and platelet-activating factor, decreased allergic symptoms, and impaired reproductive ability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygouse for disruptions in this gene display reduced allergic and autoimmune reactions. They also display an increased incidence of insulin and reduced female reproductive performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A G 15: 60,920,780 I106T probably benign Het
Aagab A C 9: 63,617,513 N35H possibly damaging Het
Abcf1 A C 17: 35,963,572 N161K possibly damaging Het
Adam11 T A 11: 102,771,261 H140Q probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Arhgef26 A T 3: 62,339,792 D99V possibly damaging Het
Arhgef28 A G 13: 97,985,380 S559P probably damaging Het
C130060K24Rik T A 6: 65,456,158 F321I probably damaging Het
Capn11 A G 17: 45,653,504 probably null Het
Ccdc157 T C 11: 4,151,912 H3R probably damaging Het
Cd101 A G 3: 101,020,462 L101P probably damaging Het
Clca3a1 A G 3: 144,759,232 V80A possibly damaging Het
Cnot6 T A 11: 49,680,023 I381F probably benign Het
Cntn3 T A 6: 102,208,131 I675F probably benign Het
Cplx2 C T 13: 54,379,593 P97S probably damaging Het
Crtac1 T A 19: 42,323,797 E159V possibly damaging Het
Cyp27a1 A G 1: 74,737,072 I416V probably benign Het
Cyp2d37-ps T C 15: 82,689,813 noncoding transcript Het
Cyp2d9 A G 15: 82,452,527 T26A probably benign Het
Cyp2j7 T A 4: 96,195,203 R503S probably damaging Het
Dclk1 A T 3: 55,516,871 probably null Het
Dgkq A T 5: 108,655,500 C231* probably null Het
Dync1i1 T A 6: 5,730,679 M38K probably benign Het
Eif2ak4 C T 2: 118,400,600 probably benign Het
Ephx2 A T 14: 66,089,512 D411E probably benign Het
Ephx2 T G 14: 66,112,220 Q34P probably benign Het
Fam192a A G 8: 94,575,720 S228P probably damaging Het
Fer1l5 A T 1: 36,409,436 N1092Y probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fzd4 A T 7: 89,407,989 K415* probably null Het
Gfi1 A T 5: 107,721,531 Y278N probably benign Het
Gm11565 T C 11: 99,915,244 M154T probably benign Het
Gm14548 C G 7: 3,898,050 probably null Het
Gm7247 A G 14: 51,521,842 I93V possibly damaging Het
Golm1 T G 13: 59,645,158 I178L probably benign Het
Grip1 A T 10: 120,038,314 D302V probably damaging Het
Gtf2h1 G A 7: 46,806,830 probably null Het
Herc2 C A 7: 56,156,901 P2372T probably damaging Het
Ighv1-59 C A 12: 115,335,166 L89F probably damaging Het
Ighv7-4 G A 12: 114,222,825 A109V possibly damaging Het
Kcnk10 G T 12: 98,440,772 Q222K probably benign Het
Klra6 A T 6: 130,018,918 M159K probably benign Het
Lzts3 T C 2: 130,637,386 T36A probably damaging Het
Mgam T A 6: 40,747,920 Y443* probably null Het
Mmp23 T A 4: 155,651,533 M221L possibly damaging Het
Mmp7 T A 9: 7,695,518 V132E probably damaging Het
Npas2 C A 1: 39,292,762 T86N probably damaging Het
Olfr1043 C T 2: 86,162,284 V222M possibly damaging Het
Olfr392 T A 11: 73,814,824 H86L probably benign Het
Papola A T 12: 105,820,346 E103V probably benign Het
Parp9 A T 16: 35,947,551 N34Y possibly damaging Het
Pcdh7 A G 5: 57,720,324 D407G probably damaging Het
Pcdhb5 T G 18: 37,322,027 Y487D probably damaging Het
Plxnb1 T C 9: 109,104,903 L733P probably benign Het
Ppfia4 T C 1: 134,324,161 D425G probably benign Het
Prss2 T G 6: 41,521,820 I6S unknown Het
Qrich2 T A 11: 116,454,153 I1693L probably benign Het
Rad52 T C 6: 119,920,182 V324A probably benign Het
Rapgef2 A T 3: 79,069,444 Y1352N possibly damaging Het
Rsad2 T G 12: 26,456,187 Y78S probably damaging Het
Scaf1 A G 7: 45,006,780 probably benign Het
Sfxn5 T C 6: 85,269,936 T131A probably damaging Het
Slc4a10 T G 2: 62,243,357 probably null Het
Syt1 A G 10: 108,500,736 V357A probably benign Het
Tenm2 T A 11: 36,046,794 D1685V probably damaging Het
Thegl A G 5: 77,016,336 D62G possibly damaging Het
Tmc3 A G 7: 83,603,335 T315A probably benign Het
Tmem266 T C 9: 55,437,209 L375P probably benign Het
Tsks T G 7: 44,953,839 L355R probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ube2f T A 1: 91,275,319 probably null Het
Usp37 A T 1: 74,492,928 V102D probably damaging Het
Usp44 G A 10: 93,847,148 probably benign Het
Vmn2r115 T C 17: 23,357,009 F527S probably benign Het
Zfp101 A C 17: 33,381,746 Y345* probably null Het
Zfp160 C A 17: 21,026,862 A558E probably benign Het
Zfp236 T C 18: 82,604,247 E1686G probably damaging Het
Zfp655 T A 5: 145,244,776 D481E probably benign Het
Zswim4 A G 8: 84,226,145 V396A probably benign Het
Other mutations in Pla2g4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Pla2g4a APN 1 149886203 missense probably benign 0.08
IGL00763:Pla2g4a APN 1 149851325 missense probably damaging 1.00
IGL01548:Pla2g4a APN 1 149932656 critical splice donor site probably null
IGL01683:Pla2g4a APN 1 149857654 missense probably benign 0.05
IGL01903:Pla2g4a APN 1 149840619 missense possibly damaging 0.51
IGL02049:Pla2g4a APN 1 149861096 missense probably benign 0.12
IGL02103:Pla2g4a APN 1 149901199 missense probably damaging 0.99
IGL03132:Pla2g4a APN 1 149902284 splice site probably benign
IGL03299:Pla2g4a APN 1 149851367 missense probably damaging 1.00
IGL03302:Pla2g4a APN 1 149864947 missense probably benign 0.00
R0110:Pla2g4a UTSW 1 149840647 missense possibly damaging 0.67
R0469:Pla2g4a UTSW 1 149840647 missense possibly damaging 0.67
R0488:Pla2g4a UTSW 1 149871445 missense probably damaging 1.00
R0606:Pla2g4a UTSW 1 149840704 missense probably benign 0.44
R1468:Pla2g4a UTSW 1 149887593 splice site probably benign
R1470:Pla2g4a UTSW 1 149840720 missense probably damaging 1.00
R1470:Pla2g4a UTSW 1 149840720 missense probably damaging 1.00
R1521:Pla2g4a UTSW 1 149857686 critical splice acceptor site probably null
R1718:Pla2g4a UTSW 1 149871523 splice site probably benign
R1778:Pla2g4a UTSW 1 149902445 splice site probably benign
R1967:Pla2g4a UTSW 1 149922081 missense probably damaging 1.00
R2063:Pla2g4a UTSW 1 149840676 missense possibly damaging 0.94
R2291:Pla2g4a UTSW 1 149901189 missense probably damaging 1.00
R3855:Pla2g4a UTSW 1 149830177 missense possibly damaging 0.86
R4512:Pla2g4a UTSW 1 149861051 splice site probably null
R4568:Pla2g4a UTSW 1 149842226 missense probably benign 0.43
R5266:Pla2g4a UTSW 1 149865167 missense possibly damaging 0.79
R5855:Pla2g4a UTSW 1 149880063 missense probably damaging 0.99
R5897:Pla2g4a UTSW 1 149865148 missense probably damaging 0.99
R6012:Pla2g4a UTSW 1 149932677 missense possibly damaging 0.55
R6246:Pla2g4a UTSW 1 149872587 missense probably damaging 1.00
R6248:Pla2g4a UTSW 1 149872587 missense probably damaging 1.00
R6258:Pla2g4a UTSW 1 149857487 missense probably benign 0.00
R6260:Pla2g4a UTSW 1 149857487 missense probably benign 0.00
R6293:Pla2g4a UTSW 1 149880047 missense probably damaging 0.98
R6310:Pla2g4a UTSW 1 149842226 missense possibly damaging 0.88
R6490:Pla2g4a UTSW 1 149851335 nonsense probably null
R6502:Pla2g4a UTSW 1 149872616 nonsense probably null
R6614:Pla2g4a UTSW 1 149842235 missense probably benign 0.07
R6671:Pla2g4a UTSW 1 149887631 missense probably benign
R6745:Pla2g4a UTSW 1 149886230 missense probably benign 0.07
R6880:Pla2g4a UTSW 1 149851451 missense possibly damaging 0.90
R7058:Pla2g4a UTSW 1 149851352 missense probably damaging 1.00
R7163:Pla2g4a UTSW 1 149840665 nonsense probably null
X0021:Pla2g4a UTSW 1 149864926 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ACGAGCATTGTTCACATCCCC -3'
(R):5'- GCCTTCCAGATGGGTGAATTTC -3'

Sequencing Primer
(F):5'- ATCCCCCGGATGATTCACTTAC -3'
(R):5'- CCAGATGGGTGAATTTCTGAATAG -3'
Posted On2018-02-27