Incidental Mutation 'R6194:Baz1b'
ID502785
Institutional Source Beutler Lab
Gene Symbol Baz1b
Ensembl Gene ENSMUSG00000002748
Gene Namebromodomain adjacent to zinc finger domain, 1B
SynonymsWSTF, Wbscr9
MMRRC Submission 044334-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6194 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location135187264-135246129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135243890 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1354 (Y1354H)
Ref Sequence ENSEMBL: ENSMUSP00000002825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002825]
Predicted Effect probably damaging
Transcript: ENSMUST00000002825
AA Change: Y1354H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002825
Gene: ENSMUSG00000002748
AA Change: Y1354H

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 21 120 2.6e-28 PFAM
low complexity region 312 335 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
coiled coil region 537 587 N/A INTRINSIC
DDT 605 669 5.59e-17 SMART
Pfam:WHIM1 725 773 2.2e-9 PFAM
low complexity region 822 835 N/A INTRINSIC
coiled coil region 854 890 N/A INTRINSIC
Pfam:WHIM2 900 935 1.3e-10 PFAM
Pfam:WHIM3 991 1029 1.5e-16 PFAM
low complexity region 1131 1148 N/A INTRINSIC
PHD 1186 1232 1.89e-14 SMART
RING 1187 1231 7.85e-2 SMART
low complexity region 1245 1277 N/A INTRINSIC
BROMO 1333 1441 3.63e-37 SMART
low complexity region 1459 1472 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136947
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bromodomain protein family. The bromodomain is a structural motif characteristic of proteins involved in chromatin-dependent regulation of transcription. This gene is deleted in Williams-Beuren syndrome, a developmental disorder caused by deletion of multiple genes at 7q11.23. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality by P2, small size at birth, impaired double strand DNA repair, and heart defects. Mice heterozygous for a null allele exhibit hypercalcemia and heart defects. Mice homozygous for an ENU mutation exhibit craniofacial and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031410I06Rik T C 5: 26,104,035 I90V probably benign Het
5330417C22Rik T C 3: 108,465,779 I600V probably benign Het
Afap1l2 T A 19: 56,922,951 R370S probably damaging Het
Alcam A G 16: 52,268,398 Y537H probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asap1 A G 15: 64,129,209 S508P probably damaging Het
Atg5 T C 10: 44,294,616 L86P probably damaging Het
Atp13a5 G A 16: 29,308,239 P502S probably damaging Het
AW209491 T A 13: 14,637,120 I186K possibly damaging Het
Card6 A T 15: 5,098,444 S1157T unknown Het
Chil6 A G 3: 106,404,876 probably null Het
Chrna1 A G 2: 73,570,472 V238A probably benign Het
Cluap1 A G 16: 3,929,906 S308G probably benign Het
Cntnap4 A G 8: 112,875,429 D1155G probably damaging Het
Cptp A G 4: 155,866,641 F123L probably damaging Het
Fbxw2 G A 2: 34,807,404 T317I probably damaging Het
Gc A T 5: 89,441,579 V197E probably benign Het
Gusb C T 5: 129,990,065 V577M possibly damaging Het
Hectd1 A T 12: 51,748,445 N2400K probably damaging Het
Hnrnph1 T A 11: 50,383,277 D340E possibly damaging Het
Hs3st1 C A 5: 39,614,405 K298N probably damaging Het
Hunk A T 16: 90,496,395 T522S probably damaging Het
Ifit3 T C 19: 34,587,627 F191S probably benign Het
Ifnab T A 4: 88,691,125 K35* probably null Het
Ifnab G T 4: 88,691,126 N34K probably damaging Het
Ighmbp2 C A 19: 3,262,003 R917L possibly damaging Het
Igkv13-84 C T 6: 68,939,932 A71V possibly damaging Het
Lim2 T A 7: 43,435,662 C159S probably damaging Het
Lrrc56 T C 7: 141,205,651 Y147H probably damaging Het
Ltn1 A G 16: 87,415,810 L621P probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mboat2 T A 12: 24,946,638 S213R probably benign Het
Mmel1 T A 4: 154,883,216 C99* probably null Het
Mrvi1 T C 7: 110,899,694 N377D probably damaging Het
Myo9a A G 9: 59,869,750 I1144V probably benign Het
Naa15 A G 3: 51,463,300 T612A probably benign Het
Naalad2 C T 9: 18,351,147 V362I probably benign Het
Nbeal1 A T 1: 60,257,484 I1178F possibly damaging Het
Nras C A 3: 103,058,953 A11E probably damaging Het
Olfr275 T A 4: 52,825,779 C127* probably null Het
Olfr681 G T 7: 105,122,170 V238L probably benign Het
Pcdhb7 A G 18: 37,342,146 T112A probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Pfkfb2 A G 1: 130,697,887 *519Q probably null Het
Prodh A T 16: 18,072,517 H515Q probably benign Het
Rbfox2 T C 15: 77,084,157 T435A possibly damaging Het
Rbks T C 5: 31,666,890 E87G probably benign Het
Scyl1 G T 19: 5,770,306 Q167K possibly damaging Het
Serpina3i T A 12: 104,266,503 D222E probably benign Het
Slc36a4 T A 9: 15,726,876 C199* probably null Het
Slx1b C T 7: 126,692,331 R187H possibly damaging Het
Stxbp5 A G 10: 9,817,339 F348L probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tfpt A T 7: 3,629,027 L28Q probably damaging Het
Trap1 G A 16: 4,054,800 T335M possibly damaging Het
Zcchc2 T A 1: 105,991,117 F110I probably damaging Het
Zfp345 A T 2: 150,472,631 C329S probably damaging Het
Other mutations in Baz1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Baz1b APN 5 135216590 missense probably damaging 0.99
IGL00589:Baz1b APN 5 135196492 missense possibly damaging 0.50
IGL00736:Baz1b APN 5 135240032 missense probably damaging 1.00
IGL02053:Baz1b APN 5 135242466 missense probably benign 0.00
IGL02197:Baz1b APN 5 135209097 missense probably benign 0.20
IGL02236:Baz1b APN 5 135217284 missense probably damaging 1.00
IGL02351:Baz1b APN 5 135244306 missense probably damaging 1.00
IGL02358:Baz1b APN 5 135244306 missense probably damaging 1.00
IGL02424:Baz1b APN 5 135217979 missense probably damaging 1.00
IGL03051:Baz1b APN 5 135217225 missense probably benign 0.02
PIT4480001:Baz1b UTSW 5 135217965 missense probably damaging 1.00
R0097:Baz1b UTSW 5 135198259 missense probably benign 0.11
R0097:Baz1b UTSW 5 135198259 missense probably benign 0.11
R0365:Baz1b UTSW 5 135240131 missense probably benign 0.00
R0655:Baz1b UTSW 5 135242430 missense probably benign 0.00
R0698:Baz1b UTSW 5 135198221 missense probably damaging 1.00
R0959:Baz1b UTSW 5 135244222 missense probably damaging 1.00
R1411:Baz1b UTSW 5 135230323 missense possibly damaging 0.73
R1469:Baz1b UTSW 5 135217979 missense probably damaging 1.00
R1469:Baz1b UTSW 5 135217979 missense probably damaging 1.00
R1511:Baz1b UTSW 5 135217782 missense probably damaging 1.00
R1557:Baz1b UTSW 5 135218243 missense possibly damaging 0.94
R1674:Baz1b UTSW 5 135205111 missense probably damaging 1.00
R1760:Baz1b UTSW 5 135242524 missense probably benign
R1951:Baz1b UTSW 5 135216739 missense probably benign 0.11
R2058:Baz1b UTSW 5 135217225 missense probably benign 0.02
R2060:Baz1b UTSW 5 135205114 missense probably damaging 1.00
R2142:Baz1b UTSW 5 135217275 missense probably damaging 1.00
R2496:Baz1b UTSW 5 135210775 missense probably damaging 1.00
R4088:Baz1b UTSW 5 135216940 missense probably damaging 0.96
R4397:Baz1b UTSW 5 135244446 missense probably damaging 1.00
R4784:Baz1b UTSW 5 135217413 missense possibly damaging 0.51
R4785:Baz1b UTSW 5 135217413 missense possibly damaging 0.51
R5386:Baz1b UTSW 5 135238059 missense probably damaging 1.00
R5653:Baz1b UTSW 5 135209097 missense probably benign 0.20
R5808:Baz1b UTSW 5 135221958 missense probably benign 0.00
R6010:Baz1b UTSW 5 135217451 missense possibly damaging 0.82
R6014:Baz1b UTSW 5 135217394 missense probably damaging 1.00
R6173:Baz1b UTSW 5 135242507 missense probably benign
R6419:Baz1b UTSW 5 135242494 missense probably benign
R6435:Baz1b UTSW 5 135237945 missense probably damaging 1.00
R7078:Baz1b UTSW 5 135217439 missense probably benign 0.04
R7341:Baz1b UTSW 5 135223116 missense probably damaging 1.00
X0027:Baz1b UTSW 5 135216892 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCATGATGCCCAAGGAAGTG -3'
(R):5'- AGGCTCCCTGTAGGAAAACAC -3'

Sequencing Primer
(F):5'- CCAAGGAAGTGATGAACTGTCTTCC -3'
(R):5'- CAGGCCAGAGCAGCACTAG -3'
Posted On2018-02-27