Incidental Mutation 'R6194:Pcdhb7'
ID502815
Institutional Source Beutler Lab
Gene Symbol Pcdhb7
Ensembl Gene ENSMUSG00000045062
Gene Nameprotocadherin beta 7
SynonymsPcdhb4B, PcdhbG
MMRRC Submission 044334-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6194 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37341702-37345202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37342146 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 112 (T112A)
Ref Sequence ENSEMBL: ENSMUSP00000051041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053037] [ENSMUST00000061717] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000053037
AA Change: T112A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051041
Gene: ENSMUSG00000045062
AA Change: T112A

DomainStartEndE-ValueType
Pfam:Cadherin_2 61 143 1.4e-32 PFAM
CA 186 271 5.47e-17 SMART
CA 295 376 4.43e-26 SMART
CA 399 480 1.04e-22 SMART
CA 504 590 2.12e-23 SMART
CA 620 701 5.73e-11 SMART
Pfam:Cadherin_C_2 718 801 5.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061717
SMART Domains Protein: ENSMUSP00000058592
Gene: ENSMUSG00000051678

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.7e-33 PFAM
CA 155 240 1.48e-22 SMART
CA 264 344 3.02e-28 SMART
CA 367 448 1.69e-22 SMART
CA 472 558 1.65e-25 SMART
CA 588 669 6.24e-12 SMART
Pfam:Cadherin_C_2 685 768 4.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031410I06Rik T C 5: 26,104,035 I90V probably benign Het
5330417C22Rik T C 3: 108,465,779 I600V probably benign Het
Afap1l2 T A 19: 56,922,951 R370S probably damaging Het
Alcam A G 16: 52,268,398 Y537H probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asap1 A G 15: 64,129,209 S508P probably damaging Het
Atg5 T C 10: 44,294,616 L86P probably damaging Het
Atp13a5 G A 16: 29,308,239 P502S probably damaging Het
AW209491 T A 13: 14,637,120 I186K possibly damaging Het
Baz1b T C 5: 135,243,890 Y1354H probably damaging Het
Card6 A T 15: 5,098,444 S1157T unknown Het
Chil6 A G 3: 106,404,876 probably null Het
Chrna1 A G 2: 73,570,472 V238A probably benign Het
Cluap1 A G 16: 3,929,906 S308G probably benign Het
Cntnap4 A G 8: 112,875,429 D1155G probably damaging Het
Cptp A G 4: 155,866,641 F123L probably damaging Het
Fbxw2 G A 2: 34,807,404 T317I probably damaging Het
Gc A T 5: 89,441,579 V197E probably benign Het
Gusb C T 5: 129,990,065 V577M possibly damaging Het
Hectd1 A T 12: 51,748,445 N2400K probably damaging Het
Hnrnph1 T A 11: 50,383,277 D340E possibly damaging Het
Hs3st1 C A 5: 39,614,405 K298N probably damaging Het
Hunk A T 16: 90,496,395 T522S probably damaging Het
Ifit3 T C 19: 34,587,627 F191S probably benign Het
Ifnab T A 4: 88,691,125 K35* probably null Het
Ifnab G T 4: 88,691,126 N34K probably damaging Het
Ighmbp2 C A 19: 3,262,003 R917L possibly damaging Het
Igkv13-84 C T 6: 68,939,932 A71V possibly damaging Het
Lim2 T A 7: 43,435,662 C159S probably damaging Het
Lrrc56 T C 7: 141,205,651 Y147H probably damaging Het
Ltn1 A G 16: 87,415,810 L621P probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mboat2 T A 12: 24,946,638 S213R probably benign Het
Mmel1 T A 4: 154,883,216 C99* probably null Het
Mrvi1 T C 7: 110,899,694 N377D probably damaging Het
Myo9a A G 9: 59,869,750 I1144V probably benign Het
Naa15 A G 3: 51,463,300 T612A probably benign Het
Naalad2 C T 9: 18,351,147 V362I probably benign Het
Nbeal1 A T 1: 60,257,484 I1178F possibly damaging Het
Nras C A 3: 103,058,953 A11E probably damaging Het
Olfr275 T A 4: 52,825,779 C127* probably null Het
Olfr681 G T 7: 105,122,170 V238L probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Pfkfb2 A G 1: 130,697,887 *519Q probably null Het
Prodh A T 16: 18,072,517 H515Q probably benign Het
Rbfox2 T C 15: 77,084,157 T435A possibly damaging Het
Rbks T C 5: 31,666,890 E87G probably benign Het
Scyl1 G T 19: 5,770,306 Q167K possibly damaging Het
Serpina3i T A 12: 104,266,503 D222E probably benign Het
Slc36a4 T A 9: 15,726,876 C199* probably null Het
Slx1b C T 7: 126,692,331 R187H possibly damaging Het
Stxbp5 A G 10: 9,817,339 F348L probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tfpt A T 7: 3,629,027 L28Q probably damaging Het
Trap1 G A 16: 4,054,800 T335M possibly damaging Het
Zcchc2 T A 1: 105,991,117 F110I probably damaging Het
Zfp345 A T 2: 150,472,631 C329S probably damaging Het
Other mutations in Pcdhb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Pcdhb7 APN 18 37343152 missense probably benign 0.35
IGL01806:Pcdhb7 APN 18 37342495 missense possibly damaging 0.60
IGL01862:Pcdhb7 APN 18 37343862 missense possibly damaging 0.81
IGL01961:Pcdhb7 APN 18 37342473 missense probably damaging 1.00
R0184:Pcdhb7 UTSW 18 37343390 missense probably benign 0.44
R0426:Pcdhb7 UTSW 18 37342804 missense probably damaging 0.99
R0576:Pcdhb7 UTSW 18 37342357 missense probably benign 0.01
R0646:Pcdhb7 UTSW 18 37343389 missense probably damaging 1.00
R0656:Pcdhb7 UTSW 18 37341901 missense probably benign 0.01
R1216:Pcdhb7 UTSW 18 37343874 missense probably damaging 0.99
R1851:Pcdhb7 UTSW 18 37342578 missense possibly damaging 0.69
R2168:Pcdhb7 UTSW 18 37343282 missense probably benign 0.05
R2312:Pcdhb7 UTSW 18 37342197 missense probably benign
R3153:Pcdhb7 UTSW 18 37343073 missense probably damaging 1.00
R3758:Pcdhb7 UTSW 18 37343026 missense possibly damaging 0.84
R3763:Pcdhb7 UTSW 18 37341883 missense probably benign
R3940:Pcdhb7 UTSW 18 37343968 missense probably damaging 1.00
R3949:Pcdhb7 UTSW 18 37343088 missense probably benign 0.00
R4418:Pcdhb7 UTSW 18 37343482 missense probably benign 0.08
R4580:Pcdhb7 UTSW 18 37342135 missense probably damaging 1.00
R4880:Pcdhb7 UTSW 18 37342231 missense probably benign 0.00
R4936:Pcdhb7 UTSW 18 37342149 nonsense probably null
R4936:Pcdhb7 UTSW 18 37342150 missense probably damaging 1.00
R5086:Pcdhb7 UTSW 18 37343109 missense possibly damaging 0.56
R5517:Pcdhb7 UTSW 18 37341793 intron probably benign
R5570:Pcdhb7 UTSW 18 37344171 missense probably benign 0.35
R5827:Pcdhb7 UTSW 18 37342024 missense probably benign 0.14
R6187:Pcdhb7 UTSW 18 37342569 missense probably benign 0.23
R6195:Pcdhb7 UTSW 18 37342656 missense probably benign 0.33
R6373:Pcdhb7 UTSW 18 37342211 nonsense probably null
R6398:Pcdhb7 UTSW 18 37343434 missense possibly damaging 0.86
R6437:Pcdhb7 UTSW 18 37342690 missense probably damaging 0.96
R6587:Pcdhb7 UTSW 18 37344103 missense probably benign
R6596:Pcdhb7 UTSW 18 37343361 missense probably damaging 0.97
R6646:Pcdhb7 UTSW 18 37343974 missense possibly damaging 0.90
R6702:Pcdhb7 UTSW 18 37341906 missense probably benign 0.03
R6923:Pcdhb7 UTSW 18 37342469 intron probably null
R6976:Pcdhb7 UTSW 18 37343578 missense probably benign 0.12
R7038:Pcdhb7 UTSW 18 37342204 missense possibly damaging 0.90
R7325:Pcdhb7 UTSW 18 37343387 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGCAGTGAGCCAACAACTC -3'
(R):5'- GTCCTGGGCTAAATTCAGTGG -3'

Sequencing Primer
(F):5'- TTTGCAGTGAGCCAACAACTCAATAC -3'
(R):5'- TAACAGAGTGCCCGGCTG -3'
Posted On2018-02-27