Incidental Mutation 'R6195:Arhgef7'
ID502857
Institutional Source Beutler Lab
Gene Symbol Arhgef7
Ensembl Gene ENSMUSG00000031511
Gene NameRho guanine nucleotide exchange factor (GEF7)
Synonymscool-1, betaPix, Cool, PIX, Pak interacting exchange factor, p85SPR, betaPix-b, betaPix-c
MMRRC Submission 044335-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.788) question?
Stock #R6195 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location11727721-11835219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11822017 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 701 (T701I)
Ref Sequence ENSEMBL: ENSMUSP00000106534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074856] [ENSMUST00000098938] [ENSMUST00000110904] [ENSMUST00000110909]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000033908
SMART Domains Protein: ENSMUSP00000033908
Gene: ENSMUSG00000031511

DomainStartEndE-ValueType
CH 3 107 7.28e-13 SMART
SH3 166 221 9.97e-26 SMART
RhoGEF 254 429 8.36e-43 SMART
PH 459 559 3.77e-9 SMART
low complexity region 600 614 N/A INTRINSIC
low complexity region 630 647 N/A INTRINSIC
low complexity region 660 672 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074856
AA Change: T544I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074399
Gene: ENSMUSG00000031511
AA Change: T544I

DomainStartEndE-ValueType
SH3 9 64 9.97e-26 SMART
RhoGEF 97 272 8.36e-43 SMART
PH 302 402 3.77e-9 SMART
low complexity region 443 457 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 503 515 N/A INTRINSIC
PDB:3L4F|C 587 646 2e-32 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000098938
AA Change: T544I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096538
Gene: ENSMUSG00000031511
AA Change: T544I

DomainStartEndE-ValueType
SH3 9 64 9.97e-26 SMART
RhoGEF 97 272 8.36e-43 SMART
PH 302 402 3.77e-9 SMART
low complexity region 443 457 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 503 515 N/A INTRINSIC
low complexity region 569 600 N/A INTRINSIC
PDB:3L4F|C 646 705 2e-32 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000110904
AA Change: T475I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106529
Gene: ENSMUSG00000031511
AA Change: T475I

DomainStartEndE-ValueType
SH3 9 64 9.97e-26 SMART
RhoGEF 97 272 8.36e-43 SMART
PH 302 402 3.77e-9 SMART
low complexity region 428 440 N/A INTRINSIC
low complexity region 494 525 N/A INTRINSIC
PDB:3L4F|C 571 630 2e-32 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000110909
AA Change: T701I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106534
Gene: ENSMUSG00000031511
AA Change: T701I

DomainStartEndE-ValueType
CH 3 107 7.28e-13 SMART
Pfam:RhoGEF67_u1 117 163 8e-21 PFAM
SH3 166 221 9.97e-26 SMART
RhoGEF 254 429 8.36e-43 SMART
PH 459 559 3.77e-9 SMART
Pfam:RhoGEF67_u2 611 711 2.3e-53 PFAM
low complexity region 726 757 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of cytoplasmic proteins that activate the Ras-like family of Rho proteins by exchanging bound GDP for GTP. It forms a complex with the small GTP binding protein Rac1 and recruits Rac1 to membrane ruffles and to focal adhesions. Multiple alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,834 probably null Het
Abtb1 T C 6: 88,840,736 E50G probably benign Het
Agbl2 T A 2: 90,813,313 D792E probably benign Het
Aoc1 C A 6: 48,908,677 N705K probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Atg10 G T 13: 91,208,436 probably null Het
Atp5c1 T C 2: 10,064,115 I116M possibly damaging Het
Baz2b T A 2: 59,907,511 Q1818L possibly damaging Het
Bod1 A G 11: 31,666,740 *174Q probably null Het
Cacna1a A G 8: 84,588,753 Y1539C probably damaging Het
Creb3 A G 4: 43,566,346 D260G probably benign Het
Cyp1b1 G T 17: 79,714,266 L16M probably damaging Het
Dhx29 T A 13: 112,964,537 S1205T probably benign Het
Dlec1 A G 9: 119,137,253 K1097E probably benign Het
Dnah7b G A 1: 46,204,269 D1578N probably damaging Het
Dok3 T C 13: 55,523,576 N394S probably benign Het
Efhb A G 17: 53,462,552 F243S possibly damaging Het
Eif2ak2 A T 17: 78,871,233 Y137* probably null Het
Eif4e1b A G 13: 54,784,205 N34S probably null Het
F2rl3 A G 8: 72,762,885 T247A probably benign Het
Fam196a T C 7: 134,918,648 D51G probably damaging Het
Fan1 A T 7: 64,354,371 H782Q probably damaging Het
Fer1l5 T C 1: 36,375,286 probably null Het
Fer1l6 T C 15: 58,637,957 S1423P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fgfbp1 T C 5: 43,979,362 D196G possibly damaging Het
Fxn G A 19: 24,262,043 R162C probably damaging Het
Fxr2 C T 11: 69,652,273 T632M probably benign Het
Gab1 A T 8: 80,879,532 Y24* probably null Het
Gcc2 T C 10: 58,270,984 S681P probably damaging Het
Git2 T C 5: 114,767,114 N94S probably benign Het
Gm17018 A G 19: 45,577,019 D144G probably damaging Het
Gm5538 G A 3: 59,752,202 V359I probably damaging Het
Gm5799 T G 14: 43,544,631 L87V probably damaging Het
Golga7b A T 19: 42,263,447 D44V probably benign Het
Hace1 T A 10: 45,670,443 I391N possibly damaging Het
Hmcn2 T C 2: 31,384,115 S1416P probably damaging Het
Hoxa11 G A 6: 52,245,701 R7C probably damaging Het
Igkv14-126 A T 6: 67,896,491 T68S possibly damaging Het
Itpr3 T C 17: 27,086,960 I164T probably damaging Het
Kif22 A G 7: 127,028,959 S540P probably damaging Het
Ldlr T A 9: 21,731,781 C34* probably null Het
Lrrtm4 T C 6: 80,021,956 L117P probably damaging Het
Mad2l1 G T 6: 66,537,628 G94C possibly damaging Het
Malrd1 C A 2: 15,695,326 H661Q probably damaging Het
Mical3 T A 6: 121,016,835 probably benign Het
Mipep T A 14: 60,872,105 W644R probably damaging Het
Mycl A G 4: 122,999,920 D171G probably damaging Het
Myof A G 19: 37,913,357 F997L possibly damaging Het
Nagpa C T 16: 5,203,749 R46H probably damaging Het
Nf1 A G 11: 79,565,975 Y629C probably damaging Het
Obscn T A 11: 58,997,207 E2164V probably damaging Het
Olfr1061 T C 2: 86,413,207 I282V probably damaging Het
Olfr1152 T C 2: 87,868,560 S190P possibly damaging Het
Olfr205 A G 16: 59,329,422 V29A possibly damaging Het
Olfr648 A T 7: 104,179,754 V218D possibly damaging Het
Pcdh20 T C 14: 88,468,052 E604G probably benign Het
Pcdhb7 G A 18: 37,342,656 V282I probably benign Het
Pcnx4 A G 12: 72,556,874 D523G possibly damaging Het
Pigx G A 16: 32,084,586 T219I probably damaging Het
Plch1 G T 3: 63,740,789 P399Q probably damaging Het
Pvrig T A 5: 138,342,275 F74I possibly damaging Het
Rsrp1 T A 4: 134,926,802 I255K probably damaging Het
Scn1a T A 2: 66,277,618 Y1588F possibly damaging Het
Serpina9 T A 12: 104,001,407 H243L probably damaging Het
Tapbp T C 17: 33,919,982 L41P probably damaging Het
Tbc1d16 T A 11: 119,210,565 K40* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbc1d23 T C 16: 57,231,350 E6G possibly damaging Het
Tdrd6 A G 17: 43,629,752 V135A probably damaging Het
Tmem87a A T 2: 120,392,175 probably null Het
Tnrc18 T A 5: 142,765,173 K1217N unknown Het
Trim33 G A 3: 103,337,532 probably null Het
Ttn T A 2: 76,737,653 Y27632F probably benign Het
Tubgcp6 A T 15: 89,122,791 D9E probably benign Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Zfp655 T A 5: 145,243,762 F143L possibly damaging Het
Other mutations in Arhgef7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgef7 APN 8 11782540 missense probably damaging 1.00
IGL01481:Arhgef7 APN 8 11815256 missense probably benign 0.01
IGL02376:Arhgef7 APN 8 11817735 missense probably damaging 1.00
IGL02812:Arhgef7 APN 8 11781245 unclassified probably benign
IGL02813:Arhgef7 APN 8 11800767 unclassified probably benign
IGL02864:Arhgef7 APN 8 11815247 missense possibly damaging 0.49
Mental_fitness UTSW 8 11800811 missense probably damaging 1.00
R0139:Arhgef7 UTSW 8 11800503 missense probably damaging 0.99
R0157:Arhgef7 UTSW 8 11785812 missense probably damaging 1.00
R0332:Arhgef7 UTSW 8 11824701 nonsense probably null
R0448:Arhgef7 UTSW 8 11819659 missense possibly damaging 0.78
R0973:Arhgef7 UTSW 8 11819659 missense possibly damaging 0.78
R1491:Arhgef7 UTSW 8 11819733 critical splice donor site probably null
R1566:Arhgef7 UTSW 8 11782620 missense possibly damaging 0.85
R1601:Arhgef7 UTSW 8 11782638 unclassified probably null
R1716:Arhgef7 UTSW 8 11808713 splice site probably null
R1717:Arhgef7 UTSW 8 11808712 unclassified probably benign
R1717:Arhgef7 UTSW 8 11808713 splice site probably null
R1719:Arhgef7 UTSW 8 11808713 splice site probably null
R1901:Arhgef7 UTSW 8 11808713 splice site probably null
R1902:Arhgef7 UTSW 8 11808713 splice site probably null
R1933:Arhgef7 UTSW 8 11808713 splice site probably null
R1934:Arhgef7 UTSW 8 11808713 splice site probably null
R1956:Arhgef7 UTSW 8 11805266 missense probably damaging 1.00
R2122:Arhgef7 UTSW 8 11728256 missense possibly damaging 0.94
R2273:Arhgef7 UTSW 8 11815010 missense possibly damaging 0.94
R2275:Arhgef7 UTSW 8 11815010 missense possibly damaging 0.94
R2306:Arhgef7 UTSW 8 11812680 nonsense probably null
R2375:Arhgef7 UTSW 8 11814995 missense probably benign 0.08
R4530:Arhgef7 UTSW 8 11800802 missense possibly damaging 0.60
R4805:Arhgef7 UTSW 8 11831552 missense probably damaging 1.00
R5204:Arhgef7 UTSW 8 11800775 nonsense probably null
R5212:Arhgef7 UTSW 8 11728388 missense probably benign 0.40
R5256:Arhgef7 UTSW 8 11800811 missense probably damaging 1.00
R5718:Arhgef7 UTSW 8 11785774 missense probably damaging 1.00
R6503:Arhgef7 UTSW 8 11833054 missense possibly damaging 0.58
R6679:Arhgef7 UTSW 8 11824667 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GGACTTTACAGAGCTGTGATGAG -3'
(R):5'- TGGATGCTCCCTAGAACACAG -3'

Sequencing Primer
(F):5'- CAGAGCTGTGATGAGAATTTCAAACC -3'
(R):5'- GGATGCTCCCTAGAACACAGTACTG -3'
Posted On2018-02-27