Incidental Mutation 'R6195:Uaca'
ID502862
Institutional Source Beutler Lab
Gene Symbol Uaca
Ensembl Gene ENSMUSG00000034485
Gene Nameuveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms2700059D02Rik, nucling
MMRRC Submission 044335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R6195 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location60794542-60880370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60870044 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 571 (R571Q)
Ref Sequence ENSEMBL: ENSMUSP00000062047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050183] [ENSMUST00000214354]
Predicted Effect probably damaging
Transcript: ENSMUST00000050183
AA Change: R571Q

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062047
Gene: ENSMUSG00000034485
AA Change: R571Q

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
ANK 35 68 2.66e3 SMART
ANK 69 98 1.96e-3 SMART
ANK 102 131 1.65e-1 SMART
ANK 135 164 1.38e-3 SMART
ANK 168 197 3.65e-3 SMART
ANK 201 230 6.26e-2 SMART
Blast:ANK 234 263 7e-9 BLAST
coiled coil region 301 381 N/A INTRINSIC
coiled coil region 445 626 N/A INTRINSIC
Pfam:TolA_bind_tri 869 943 4e-11 PFAM
coiled coil region 1009 1382 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214354
AA Change: R569Q

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216574
Predicted Effect probably benign
Transcript: ENSMUST00000217656
Meta Mutation Damage Score 0.02 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (76/78)
MGI Phenotype PHENOTYPE: Homozygous mice display swelling of and inflammatory lesions in the preputial gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,834 probably null Het
Abtb1 T C 6: 88,840,736 E50G probably benign Het
Agbl2 T A 2: 90,813,313 D792E probably benign Het
Aoc1 C A 6: 48,908,677 N705K probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Arhgef7 C T 8: 11,822,017 T701I probably damaging Het
Atg10 G T 13: 91,208,436 probably null Het
Atp5c1 T C 2: 10,064,115 I116M possibly damaging Het
Baz2b T A 2: 59,907,511 Q1818L possibly damaging Het
Bod1 A G 11: 31,666,740 *174Q probably null Het
Cacna1a A G 8: 84,588,753 Y1539C probably damaging Het
Creb3 A G 4: 43,566,346 D260G probably benign Het
Cyp1b1 G T 17: 79,714,266 L16M probably damaging Het
Dhx29 T A 13: 112,964,537 S1205T probably benign Het
Dlec1 A G 9: 119,137,253 K1097E probably benign Het
Dnah7b G A 1: 46,204,269 D1578N probably damaging Het
Dok3 T C 13: 55,523,576 N394S probably benign Het
Efhb A G 17: 53,462,552 F243S possibly damaging Het
Eif2ak2 A T 17: 78,871,233 Y137* probably null Het
Eif4e1b A G 13: 54,784,205 N34S probably null Het
F2rl3 A G 8: 72,762,885 T247A probably benign Het
Fam196a T C 7: 134,918,648 D51G probably damaging Het
Fan1 A T 7: 64,354,371 H782Q probably damaging Het
Fer1l5 T C 1: 36,375,286 probably null Het
Fer1l6 T C 15: 58,637,957 S1423P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fgfbp1 T C 5: 43,979,362 D196G possibly damaging Het
Fxn G A 19: 24,262,043 R162C probably damaging Het
Fxr2 C T 11: 69,652,273 T632M probably benign Het
Gab1 A T 8: 80,879,532 Y24* probably null Het
Gcc2 T C 10: 58,270,984 S681P probably damaging Het
Git2 T C 5: 114,767,114 N94S probably benign Het
Gm17018 A G 19: 45,577,019 D144G probably damaging Het
Gm5538 G A 3: 59,752,202 V359I probably damaging Het
Gm5799 T G 14: 43,544,631 L87V probably damaging Het
Golga7b A T 19: 42,263,447 D44V probably benign Het
Hace1 T A 10: 45,670,443 I391N possibly damaging Het
Hmcn2 T C 2: 31,384,115 S1416P probably damaging Het
Hoxa11 G A 6: 52,245,701 R7C probably damaging Het
Igkv14-126 A T 6: 67,896,491 T68S possibly damaging Het
Itpr3 T C 17: 27,086,960 I164T probably damaging Het
Kif22 A G 7: 127,028,959 S540P probably damaging Het
Ldlr T A 9: 21,731,781 C34* probably null Het
Lrrtm4 T C 6: 80,021,956 L117P probably damaging Het
Mad2l1 G T 6: 66,537,628 G94C possibly damaging Het
Malrd1 C A 2: 15,695,326 H661Q probably damaging Het
Mical3 T A 6: 121,016,835 probably benign Het
Mipep T A 14: 60,872,105 W644R probably damaging Het
Mycl A G 4: 122,999,920 D171G probably damaging Het
Myof A G 19: 37,913,357 F997L possibly damaging Het
Nagpa C T 16: 5,203,749 R46H probably damaging Het
Nf1 A G 11: 79,565,975 Y629C probably damaging Het
Obscn T A 11: 58,997,207 E2164V probably damaging Het
Olfr1061 T C 2: 86,413,207 I282V probably damaging Het
Olfr1152 T C 2: 87,868,560 S190P possibly damaging Het
Olfr205 A G 16: 59,329,422 V29A possibly damaging Het
Olfr648 A T 7: 104,179,754 V218D possibly damaging Het
Pcdh20 T C 14: 88,468,052 E604G probably benign Het
Pcdhb7 G A 18: 37,342,656 V282I probably benign Het
Pcnx4 A G 12: 72,556,874 D523G possibly damaging Het
Pigx G A 16: 32,084,586 T219I probably damaging Het
Plch1 G T 3: 63,740,789 P399Q probably damaging Het
Pvrig T A 5: 138,342,275 F74I possibly damaging Het
Rsrp1 T A 4: 134,926,802 I255K probably damaging Het
Scn1a T A 2: 66,277,618 Y1588F possibly damaging Het
Serpina9 T A 12: 104,001,407 H243L probably damaging Het
Tapbp T C 17: 33,919,982 L41P probably damaging Het
Tbc1d16 T A 11: 119,210,565 K40* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbc1d23 T C 16: 57,231,350 E6G possibly damaging Het
Tdrd6 A G 17: 43,629,752 V135A probably damaging Het
Tmem87a A T 2: 120,392,175 probably null Het
Tnrc18 T A 5: 142,765,173 K1217N unknown Het
Trim33 G A 3: 103,337,532 probably null Het
Ttn T A 2: 76,737,653 Y27632F probably benign Het
Tubgcp6 A T 15: 89,122,791 D9E probably benign Het
Zfp655 T A 5: 145,243,762 F143L possibly damaging Het
Other mutations in Uaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Uaca APN 9 60872225 missense probably benign
IGL01751:Uaca APN 9 60869857 missense probably damaging 1.00
IGL02868:Uaca APN 9 60863637 missense probably damaging 1.00
IGL02977:Uaca APN 9 60866380 missense probably benign 0.00
IGL03037:Uaca APN 9 60840865 missense probably damaging 1.00
IGL03060:Uaca APN 9 60869866 missense probably damaging 1.00
IGL03083:Uaca APN 9 60863663 missense probably benign 0.28
IGL03266:Uaca APN 9 60863407 missense probably damaging 1.00
IGL03346:Uaca APN 9 60854318 missense probably damaging 1.00
R0408:Uaca UTSW 9 60871859 missense possibly damaging 0.71
R0567:Uaca UTSW 9 60871381 missense probably benign 0.01
R0598:Uaca UTSW 9 60870921 nonsense probably null
R0603:Uaca UTSW 9 60871097 missense possibly damaging 0.60
R0655:Uaca UTSW 9 60872029 missense probably benign 0.03
R0707:Uaca UTSW 9 60848618 splice site probably benign
R0791:Uaca UTSW 9 60872059 missense possibly damaging 0.50
R1466:Uaca UTSW 9 60854321 missense possibly damaging 0.88
R1466:Uaca UTSW 9 60854321 missense possibly damaging 0.88
R1520:Uaca UTSW 9 60871381 missense probably benign 0.30
R1673:Uaca UTSW 9 60872156 missense probably damaging 1.00
R1894:Uaca UTSW 9 60870436 missense possibly damaging 0.87
R1997:Uaca UTSW 9 60870341 missense probably damaging 1.00
R2042:Uaca UTSW 9 60869891 missense probably damaging 1.00
R2095:Uaca UTSW 9 60840843 missense probably benign 0.00
R2148:Uaca UTSW 9 60869679 missense probably damaging 1.00
R2384:Uaca UTSW 9 60869917 missense probably damaging 1.00
R3110:Uaca UTSW 9 60871499 missense probably damaging 1.00
R3112:Uaca UTSW 9 60871499 missense probably damaging 1.00
R4001:Uaca UTSW 9 60871084 missense probably benign 0.04
R4155:Uaca UTSW 9 60871753 missense probably benign 0.02
R4156:Uaca UTSW 9 60871753 missense probably benign 0.02
R4157:Uaca UTSW 9 60871753 missense probably benign 0.02
R4410:Uaca UTSW 9 60869891 missense probably damaging 1.00
R4674:Uaca UTSW 9 60854429 missense possibly damaging 0.94
R4871:Uaca UTSW 9 60846001 missense probably damaging 1.00
R5130:Uaca UTSW 9 60880228 missense probably damaging 0.96
R5328:Uaca UTSW 9 60870532 missense probably benign 0.44
R5358:Uaca UTSW 9 60871148 missense probably benign
R5415:Uaca UTSW 9 60870139 missense possibly damaging 0.65
R5437:Uaca UTSW 9 60871451 missense probably benign
R5647:Uaca UTSW 9 60872098 missense probably benign 0.28
R5710:Uaca UTSW 9 60871811 missense probably damaging 1.00
R5920:Uaca UTSW 9 60869603 missense probably benign 0.19
R5931:Uaca UTSW 9 60872012 missense probably damaging 0.97
R5933:Uaca UTSW 9 60840956 missense probably damaging 1.00
R5959:Uaca UTSW 9 60870770 missense probably damaging 1.00
R6193:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6242:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6243:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6244:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6274:Uaca UTSW 9 60850291 splice site probably null
R6670:Uaca UTSW 9 60872024 missense probably benign 0.09
R6883:Uaca UTSW 9 60869891 missense probably damaging 1.00
R7011:Uaca UTSW 9 60870368 missense probably damaging 1.00
R7111:Uaca UTSW 9 60871838 missense probably benign 0.06
R7146:Uaca UTSW 9 60870413 missense probably damaging 0.99
X0067:Uaca UTSW 9 60859149 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CCCTCAAAGACGTGCAGAAG -3'
(R):5'- TTTCTCTGTGGGGACAGAAAGG -3'

Sequencing Primer
(F):5'- CGTGCAGAAGAGGATGTATGAGTCC -3'
(R):5'- CAGAAAGGGCCAGCTTAGC -3'
Posted On2018-02-27