Incidental Mutation 'R6195:Mipep'
ID502878
Institutional Source Beutler Lab
Gene Symbol Mipep
Ensembl Gene ENSMUSG00000021993
Gene Namemitochondrial intermediate peptidase
Synonyms5730405E07Rik
MMRRC Submission 044335-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R6195 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location60784573-60905478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60872105 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 644 (W644R)
Ref Sequence ENSEMBL: ENSMUSP00000153502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063562] [ENSMUST00000224635] [ENSMUST00000225506]
Predicted Effect probably damaging
Transcript: ENSMUST00000063562
AA Change: W644R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069840
Gene: ENSMUSG00000021993
AA Change: W644R

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:Peptidase_M3 252 697 5.4e-145 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224635
AA Change: W644R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225506
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene performs the final step in processing a specific class of nuclear-encoded proteins targeted to the mitochondrial matrix or inner membrane. This protein is primarily involved in the maturation of oxidative phosphorylation (OXPHOS)-related proteins. This gene may contribute to the functional effects of frataxin deficiency and the clinical manifestations of Friedreich ataxia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,834 probably null Het
Abtb1 T C 6: 88,840,736 E50G probably benign Het
Agbl2 T A 2: 90,813,313 D792E probably benign Het
Aoc1 C A 6: 48,908,677 N705K probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Arhgef7 C T 8: 11,822,017 T701I probably damaging Het
Atg10 G T 13: 91,208,436 probably null Het
Atp5c1 T C 2: 10,064,115 I116M possibly damaging Het
Baz2b T A 2: 59,907,511 Q1818L possibly damaging Het
Bod1 A G 11: 31,666,740 *174Q probably null Het
Cacna1a A G 8: 84,588,753 Y1539C probably damaging Het
Creb3 A G 4: 43,566,346 D260G probably benign Het
Cyp1b1 G T 17: 79,714,266 L16M probably damaging Het
Dhx29 T A 13: 112,964,537 S1205T probably benign Het
Dlec1 A G 9: 119,137,253 K1097E probably benign Het
Dnah7b G A 1: 46,204,269 D1578N probably damaging Het
Dok3 T C 13: 55,523,576 N394S probably benign Het
Efhb A G 17: 53,462,552 F243S possibly damaging Het
Eif2ak2 A T 17: 78,871,233 Y137* probably null Het
Eif4e1b A G 13: 54,784,205 N34S probably null Het
F2rl3 A G 8: 72,762,885 T247A probably benign Het
Fam196a T C 7: 134,918,648 D51G probably damaging Het
Fan1 A T 7: 64,354,371 H782Q probably damaging Het
Fer1l5 T C 1: 36,375,286 probably null Het
Fer1l6 T C 15: 58,637,957 S1423P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fgfbp1 T C 5: 43,979,362 D196G possibly damaging Het
Fxn G A 19: 24,262,043 R162C probably damaging Het
Fxr2 C T 11: 69,652,273 T632M probably benign Het
Gab1 A T 8: 80,879,532 Y24* probably null Het
Gcc2 T C 10: 58,270,984 S681P probably damaging Het
Git2 T C 5: 114,767,114 N94S probably benign Het
Gm17018 A G 19: 45,577,019 D144G probably damaging Het
Gm5538 G A 3: 59,752,202 V359I probably damaging Het
Gm5799 T G 14: 43,544,631 L87V probably damaging Het
Golga7b A T 19: 42,263,447 D44V probably benign Het
Hace1 T A 10: 45,670,443 I391N possibly damaging Het
Hmcn2 T C 2: 31,384,115 S1416P probably damaging Het
Hoxa11 G A 6: 52,245,701 R7C probably damaging Het
Igkv14-126 A T 6: 67,896,491 T68S possibly damaging Het
Itpr3 T C 17: 27,086,960 I164T probably damaging Het
Kif22 A G 7: 127,028,959 S540P probably damaging Het
Ldlr T A 9: 21,731,781 C34* probably null Het
Lrrtm4 T C 6: 80,021,956 L117P probably damaging Het
Mad2l1 G T 6: 66,537,628 G94C possibly damaging Het
Malrd1 C A 2: 15,695,326 H661Q probably damaging Het
Mical3 T A 6: 121,016,835 probably benign Het
Mycl A G 4: 122,999,920 D171G probably damaging Het
Myof A G 19: 37,913,357 F997L possibly damaging Het
Nagpa C T 16: 5,203,749 R46H probably damaging Het
Nf1 A G 11: 79,565,975 Y629C probably damaging Het
Obscn T A 11: 58,997,207 E2164V probably damaging Het
Olfr1061 T C 2: 86,413,207 I282V probably damaging Het
Olfr1152 T C 2: 87,868,560 S190P possibly damaging Het
Olfr205 A G 16: 59,329,422 V29A possibly damaging Het
Olfr648 A T 7: 104,179,754 V218D possibly damaging Het
Pcdh20 T C 14: 88,468,052 E604G probably benign Het
Pcdhb7 G A 18: 37,342,656 V282I probably benign Het
Pcnx4 A G 12: 72,556,874 D523G possibly damaging Het
Pigx G A 16: 32,084,586 T219I probably damaging Het
Plch1 G T 3: 63,740,789 P399Q probably damaging Het
Pvrig T A 5: 138,342,275 F74I possibly damaging Het
Rsrp1 T A 4: 134,926,802 I255K probably damaging Het
Scn1a T A 2: 66,277,618 Y1588F possibly damaging Het
Serpina9 T A 12: 104,001,407 H243L probably damaging Het
Tapbp T C 17: 33,919,982 L41P probably damaging Het
Tbc1d16 T A 11: 119,210,565 K40* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbc1d23 T C 16: 57,231,350 E6G possibly damaging Het
Tdrd6 A G 17: 43,629,752 V135A probably damaging Het
Tmem87a A T 2: 120,392,175 probably null Het
Tnrc18 T A 5: 142,765,173 K1217N unknown Het
Trim33 G A 3: 103,337,532 probably null Het
Ttn T A 2: 76,737,653 Y27632F probably benign Het
Tubgcp6 A T 15: 89,122,791 D9E probably benign Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Zfp655 T A 5: 145,243,762 F143L possibly damaging Het
Other mutations in Mipep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Mipep APN 14 60875260 missense probably benign 0.43
IGL00476:Mipep APN 14 60827361 missense probably damaging 1.00
IGL01319:Mipep APN 14 60843271 missense probably benign 0.00
IGL01608:Mipep APN 14 60802230 missense possibly damaging 0.65
IGL01621:Mipep APN 14 60796165 splice site probably benign
PIT4585001:Mipep UTSW 14 60784835 missense probably benign 0.01
R0635:Mipep UTSW 14 60829390 missense probably damaging 0.97
R1180:Mipep UTSW 14 60834056 missense probably damaging 1.00
R1463:Mipep UTSW 14 60788146 splice site probably benign
R1831:Mipep UTSW 14 60872063 missense probably damaging 1.00
R1833:Mipep UTSW 14 60872063 missense probably damaging 1.00
R1852:Mipep UTSW 14 60843240 nonsense probably null
R2115:Mipep UTSW 14 60787380 missense probably damaging 0.96
R2285:Mipep UTSW 14 60787394 missense possibly damaging 0.94
R3890:Mipep UTSW 14 60808995 missense probably damaging 1.00
R3892:Mipep UTSW 14 60808995 missense probably damaging 1.00
R4078:Mipep UTSW 14 60846477 missense probably damaging 1.00
R4509:Mipep UTSW 14 60827321 missense probably damaging 1.00
R4619:Mipep UTSW 14 60903416 missense probably damaging 0.97
R4707:Mipep UTSW 14 60872103 missense probably damaging 0.98
R4804:Mipep UTSW 14 60802952 missense probably damaging 1.00
R4870:Mipep UTSW 14 60802880 nonsense probably null
R4964:Mipep UTSW 14 60784782 missense probably damaging 0.97
R4966:Mipep UTSW 14 60784782 missense probably damaging 0.97
R4984:Mipep UTSW 14 60788182 missense possibly damaging 0.87
R5074:Mipep UTSW 14 60809013 missense probably benign 0.02
R5090:Mipep UTSW 14 60802299 missense possibly damaging 0.92
R5131:Mipep UTSW 14 60903374 missense probably damaging 1.00
R5569:Mipep UTSW 14 60802934 missense probably damaging 1.00
R6162:Mipep UTSW 14 60787404 missense probably damaging 0.99
R6233:Mipep UTSW 14 60872105 missense probably damaging 1.00
R6680:Mipep UTSW 14 60788223 missense possibly damaging 0.67
R7120:Mipep UTSW 14 60875247 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- ACAATGGTGATACTGTGACGTG -3'
(R):5'- ATGGCCAGGACCACAAAGTTG -3'

Sequencing Primer
(F):5'- AATGGTGATACTGTGACGTGACTCC -3'
(R):5'- TGTAAGCAACTGCCATTGGATGC -3'
Posted On2018-02-27