Incidental Mutation 'R6195:Araf'
ID502898
Institutional Source Beutler Lab
Gene Symbol Araf
Ensembl Gene ENSMUSG00000001127
Gene NameAraf proto-oncogene, serine/threonine kinase
Synonyms1200013E08Rik, Araf1, A-Raf
MMRRC Submission 044335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R6195 (G1)
Quality Score221.999
Status Validated
ChromosomeX
Chromosomal Location20797814-20860519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20860100 bp
ZygosityHomozygous
Amino Acid Change Arginine to Leucine at position 601 (R601L)
Ref Sequence ENSEMBL: ENSMUSP00000001155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001155] [ENSMUST00000081893] [ENSMUST00000115345] [ENSMUST00000136451]
Predicted Effect probably damaging
Transcript: ENSMUST00000001155
AA Change: R601L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001155
Gene: ENSMUSG00000001127
AA Change: R601L

DomainStartEndE-ValueType
RBD 19 91 1.46e-28 SMART
C1 99 144 7.68e-12 SMART
low complexity region 243 268 N/A INTRINSIC
Pfam:Pkinase_Tyr 308 565 1.9e-61 PFAM
Pfam:Pkinase 308 566 1.7e-56 PFAM
Pfam:Kinase-like 388 555 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081893
SMART Domains Protein: ENSMUSP00000080568
Gene: ENSMUSG00000037217

DomainStartEndE-ValueType
Pfam:Synapsin_N 1 32 1.3e-23 PFAM
low complexity region 87 94 N/A INTRINSIC
Pfam:Synapsin 111 212 7.8e-47 PFAM
Pfam:Synapsin_C 214 416 3.2e-124 PFAM
low complexity region 427 440 N/A INTRINSIC
low complexity region 450 491 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 579 600 N/A INTRINSIC
low complexity region 608 636 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115345
SMART Domains Protein: ENSMUSP00000111002
Gene: ENSMUSG00000037217

DomainStartEndE-ValueType
Pfam:Synapsin_N 1 32 1.3e-23 PFAM
low complexity region 87 94 N/A INTRINSIC
Pfam:Synapsin 110 212 3.2e-60 PFAM
Pfam:Synapsin_C 214 416 1.1e-132 PFAM
Pfam:RimK 229 409 3.3e-8 PFAM
low complexity region 427 440 N/A INTRINSIC
low complexity region 450 491 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 579 600 N/A INTRINSIC
low complexity region 608 636 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000128250
AA Change: R199L
SMART Domains Protein: ENSMUSP00000119544
Gene: ENSMUSG00000001127
AA Change: R199L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 5 109 3.8e-15 PFAM
Pfam:Pkinase 16 109 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136451
SMART Domains Protein: ENSMUSP00000115793
Gene: ENSMUSG00000001127

DomainStartEndE-ValueType
RBD 56 128 1.46e-28 SMART
C1 136 181 7.68e-12 SMART
low complexity region 280 305 N/A INTRINSIC
Pfam:Pkinase_Tyr 345 401 2.3e-7 PFAM
Pfam:Pkinase 345 403 7.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176786
Meta Mutation Damage Score 0.1624 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene belongs to the RAF subfamily of the Ser/Thr protein kinase family, and maybe involved in cell growth and development. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous females or hemizygous males for a null targeted mutation show variable genetic background effects, from preweaning death, wasting, tremors, distended colon and small thymus to normal survival and breeding with mild neurological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,834 probably null Het
Abtb1 T C 6: 88,840,736 E50G probably benign Het
Agbl2 T A 2: 90,813,313 D792E probably benign Het
Aoc1 C A 6: 48,908,677 N705K probably damaging Het
Arhgef7 C T 8: 11,822,017 T701I probably damaging Het
Atg10 G T 13: 91,208,436 probably null Het
Atp5c1 T C 2: 10,064,115 I116M possibly damaging Het
Baz2b T A 2: 59,907,511 Q1818L possibly damaging Het
Bod1 A G 11: 31,666,740 *174Q probably null Het
Cacna1a A G 8: 84,588,753 Y1539C probably damaging Het
Creb3 A G 4: 43,566,346 D260G probably benign Het
Cyp1b1 G T 17: 79,714,266 L16M probably damaging Het
Dhx29 T A 13: 112,964,537 S1205T probably benign Het
Dlec1 A G 9: 119,137,253 K1097E probably benign Het
Dnah7b G A 1: 46,204,269 D1578N probably damaging Het
Dok3 T C 13: 55,523,576 N394S probably benign Het
Efhb A G 17: 53,462,552 F243S possibly damaging Het
Eif2ak2 A T 17: 78,871,233 Y137* probably null Het
Eif4e1b A G 13: 54,784,205 N34S probably null Het
F2rl3 A G 8: 72,762,885 T247A probably benign Het
Fam196a T C 7: 134,918,648 D51G probably damaging Het
Fan1 A T 7: 64,354,371 H782Q probably damaging Het
Fer1l5 T C 1: 36,375,286 probably null Het
Fer1l6 T C 15: 58,637,957 S1423P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fgfbp1 T C 5: 43,979,362 D196G possibly damaging Het
Fxn G A 19: 24,262,043 R162C probably damaging Het
Fxr2 C T 11: 69,652,273 T632M probably benign Het
Gab1 A T 8: 80,879,532 Y24* probably null Het
Gcc2 T C 10: 58,270,984 S681P probably damaging Het
Git2 T C 5: 114,767,114 N94S probably benign Het
Gm17018 A G 19: 45,577,019 D144G probably damaging Het
Gm5538 G A 3: 59,752,202 V359I probably damaging Het
Gm5799 T G 14: 43,544,631 L87V probably damaging Het
Golga7b A T 19: 42,263,447 D44V probably benign Het
Hace1 T A 10: 45,670,443 I391N possibly damaging Het
Hmcn2 T C 2: 31,384,115 S1416P probably damaging Het
Hoxa11 G A 6: 52,245,701 R7C probably damaging Het
Igkv14-126 A T 6: 67,896,491 T68S possibly damaging Het
Itpr3 T C 17: 27,086,960 I164T probably damaging Het
Kif22 A G 7: 127,028,959 S540P probably damaging Het
Ldlr T A 9: 21,731,781 C34* probably null Het
Lrrtm4 T C 6: 80,021,956 L117P probably damaging Het
Mad2l1 G T 6: 66,537,628 G94C possibly damaging Het
Malrd1 C A 2: 15,695,326 H661Q probably damaging Het
Mical3 T A 6: 121,016,835 probably benign Het
Mipep T A 14: 60,872,105 W644R probably damaging Het
Mycl A G 4: 122,999,920 D171G probably damaging Het
Myof A G 19: 37,913,357 F997L possibly damaging Het
Nagpa C T 16: 5,203,749 R46H probably damaging Het
Nf1 A G 11: 79,565,975 Y629C probably damaging Het
Obscn T A 11: 58,997,207 E2164V probably damaging Het
Olfr1061 T C 2: 86,413,207 I282V probably damaging Het
Olfr1152 T C 2: 87,868,560 S190P possibly damaging Het
Olfr205 A G 16: 59,329,422 V29A possibly damaging Het
Olfr648 A T 7: 104,179,754 V218D possibly damaging Het
Pcdh20 T C 14: 88,468,052 E604G probably benign Het
Pcdhb7 G A 18: 37,342,656 V282I probably benign Het
Pcnx4 A G 12: 72,556,874 D523G possibly damaging Het
Pigx G A 16: 32,084,586 T219I probably damaging Het
Plch1 G T 3: 63,740,789 P399Q probably damaging Het
Pvrig T A 5: 138,342,275 F74I possibly damaging Het
Rsrp1 T A 4: 134,926,802 I255K probably damaging Het
Scn1a T A 2: 66,277,618 Y1588F possibly damaging Het
Serpina9 T A 12: 104,001,407 H243L probably damaging Het
Tapbp T C 17: 33,919,982 L41P probably damaging Het
Tbc1d16 T A 11: 119,210,565 K40* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbc1d23 T C 16: 57,231,350 E6G possibly damaging Het
Tdrd6 A G 17: 43,629,752 V135A probably damaging Het
Tmem87a A T 2: 120,392,175 probably null Het
Tnrc18 T A 5: 142,765,173 K1217N unknown Het
Trim33 G A 3: 103,337,532 probably null Het
Ttn T A 2: 76,737,653 Y27632F probably benign Het
Tubgcp6 A T 15: 89,122,791 D9E probably benign Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Zfp655 T A 5: 145,243,762 F143L possibly damaging Het
Other mutations in Araf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02244:Araf APN X 20853596 splice site probably benign
IGL02484:Araf APN X 20853909 splice site probably benign
R1496:Araf UTSW X 20859704 missense probably damaging 1.00
R2228:Araf UTSW X 20851673 missense probably benign 0.30
R3732:Araf UTSW X 20850226 critical splice acceptor site probably benign
R6193:Araf UTSW X 20860100 missense probably damaging 0.98
R6194:Araf UTSW X 20860100 missense probably damaging 0.98
R6242:Araf UTSW X 20860100 missense probably damaging 0.98
R6243:Araf UTSW X 20860100 missense probably damaging 0.98
R6244:Araf UTSW X 20860100 missense probably damaging 0.98
R6274:Araf UTSW X 20860100 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCTCTGGGACTCTGGACAC -3'
(R):5'- CAGCCATTGGAGATAAAACAGC -3'

Sequencing Primer
(F):5'- TGGGACTCTGGACACCCCTC -3'
(R):5'- GAGAAAGCAGGAGACCTCAGTTTTTG -3'
Posted On2018-02-27