Incidental Mutation 'R6196:Trpm7'
ID502908
Institutional Source Beutler Lab
Gene Symbol Trpm7
Ensembl Gene ENSMUSG00000027365
Gene Nametransient receptor potential cation channel, subfamily M, member 7
SynonymsLTRPC7, 2310022G15Rik, CHAK, CHAK1, Ltpr7, 4833414K03Rik, 5033407O22Rik, TRP-PLIK
MMRRC Submission 044336-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6196 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location126791565-126876230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126825639 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 811 (P811S)
Ref Sequence ENSEMBL: ENSMUSP00000099513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028843] [ENSMUST00000103224]
PDB Structure
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (AMPPNP COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (ADP-MG COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (APO) [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028843
AA Change: P811S

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028843
Gene: ENSMUSG00000027365
AA Change: P811S

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
Pfam:Ion_trans 887 1096 3e-8 PFAM
PDB:3E7K|H 1198 1249 6e-27 PDB
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1545 6e-64 BLAST
Alpha_kinase 1596 1813 3.77e-89 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103224
AA Change: P811S

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099513
Gene: ENSMUSG00000027365
AA Change: P811S

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
Pfam:Ion_trans 855 1108 1.7e-9 PFAM
Pfam:TRPM_tetra 1194 1249 3.3e-29 PFAM
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1546 2e-64 BLAST
Alpha_kinase 1597 1814 3.77e-89 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132003
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele display embryonic lehality. Mice with conditional deletion in developing thymocytes display a block in thymopoiesis. Mice homozygous for a kinase deleted allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit altered magnesium homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A T 8: 105,709,922 H241L possibly damaging Het
Acap1 T C 11: 69,887,067 D115G probably damaging Het
Acvr2b T C 9: 119,433,403 V510A possibly damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Agr2 A T 12: 35,995,592 K26* probably null Het
Aox4 T A 1: 58,217,526 I69N probably damaging Het
Asb4 G A 6: 5,390,699 G31R probably benign Het
Atp6v1c2 C A 12: 17,301,186 E105* probably null Het
Bend6 A G 1: 33,878,428 Y44H probably damaging Het
Btn2a2 C T 13: 23,487,845 V25M possibly damaging Het
Cab39l T A 14: 59,499,590 L53Q probably damaging Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Cdc14b C T 13: 64,205,524 probably benign Het
Cenpu A G 8: 46,562,580 R177G probably benign Het
Chit1 C A 1: 134,146,643 Y229* probably null Het
Crybg2 C A 4: 134,081,139 S1350R probably damaging Het
Ctdspl2 A G 2: 121,978,892 probably null Het
Ctsr A T 13: 61,160,531 H266Q probably benign Het
Extl3 T A 14: 65,076,135 M533L probably benign Het
Fam162b C A 10: 51,587,410 probably null Het
Fbxo28 T C 1: 182,329,889 K121R probably damaging Het
Fsip2 A C 2: 82,989,883 E5320A possibly damaging Het
Galc A T 12: 98,259,162 D56E probably damaging Het
Gm11639 T G 11: 104,855,560 I2279S probably benign Het
Gm5468 A G 15: 25,414,395 probably benign Het
Hk1 T A 10: 62,299,259 H24L probably damaging Het
Igkv5-45 A G 6: 69,775,981 V39A possibly damaging Het
Lemd2 G A 17: 27,193,002 Q439* probably null Het
Lgi1 A G 19: 38,305,809 N295S probably benign Het
Macc1 T G 12: 119,446,050 S184R probably damaging Het
Msmo1 A G 8: 64,727,884 probably benign Het
Muc5b C A 7: 141,851,596 R914S unknown Het
Olfr1 G A 11: 73,395,473 A183V probably benign Het
Olfr1464-ps1 A G 19: 13,282,926 I44T probably benign Het
Olfr23 G A 11: 73,940,809 A188T possibly damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Olfr959 G A 9: 39,572,480 P260S possibly damaging Het
Plekha5 T C 6: 140,579,453 S14P probably benign Het
Pus10 A G 11: 23,672,638 K86R probably benign Het
Rab37 T C 11: 115,160,306 V147A probably benign Het
Sin3a T A 9: 57,103,929 I490N probably damaging Het
Slc27a4 A G 2: 29,805,750 D99G probably benign Het
Slc43a2 C T 11: 75,568,380 R413* probably null Het
Syna G T 5: 134,559,612 T161N probably benign Het
T A G 17: 8,437,164 D86G possibly damaging Het
Tanc1 G A 2: 59,844,022 E1817K possibly damaging Het
Tap2 C A 17: 34,214,410 Q516K possibly damaging Het
Tcaf1 A T 6: 42,676,807 D717E probably damaging Het
Tcf20 G T 15: 82,851,986 Q1755K possibly damaging Het
Tctex1d1 A G 4: 102,992,569 E63G possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Uhrf1bp1l T G 10: 89,805,333 S789A probably benign Het
Vmn2r59 A G 7: 42,012,255 V712A probably benign Het
Vwc2l T A 1: 70,729,021 D34E probably damaging Het
Wdr35 A G 12: 9,027,632 K1091E probably benign Het
Other mutations in Trpm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Trpm7 APN 2 126829031 missense possibly damaging 0.82
IGL01084:Trpm7 APN 2 126846072 critical splice donor site probably null
IGL01634:Trpm7 APN 2 126826818 missense probably damaging 1.00
IGL01678:Trpm7 APN 2 126816799 missense probably damaging 0.99
IGL02005:Trpm7 APN 2 126813184 missense probably damaging 0.97
IGL02064:Trpm7 APN 2 126797943 missense probably damaging 1.00
IGL02156:Trpm7 APN 2 126799243 unclassified probably benign
IGL02172:Trpm7 APN 2 126795328 missense possibly damaging 0.94
IGL02334:Trpm7 APN 2 126807362 missense probably benign
IGL02375:Trpm7 APN 2 126825744 missense probably damaging 1.00
IGL02388:Trpm7 APN 2 126819891 missense possibly damaging 0.80
IGL02552:Trpm7 APN 2 126840779 missense probably damaging 1.00
IGL02684:Trpm7 APN 2 126846159 missense probably damaging 0.99
IGL02901:Trpm7 APN 2 126807287 critical splice donor site probably null
P0037:Trpm7 UTSW 2 126816757 splice site probably benign
R0038:Trpm7 UTSW 2 126795468 missense probably damaging 1.00
R0139:Trpm7 UTSW 2 126812771 missense probably benign
R0165:Trpm7 UTSW 2 126797513 missense probably damaging 0.97
R0511:Trpm7 UTSW 2 126826718 nonsense probably null
R0543:Trpm7 UTSW 2 126848529 missense probably damaging 1.00
R0784:Trpm7 UTSW 2 126846072 critical splice donor site probably null
R0844:Trpm7 UTSW 2 126835508 missense probably damaging 1.00
R0865:Trpm7 UTSW 2 126799239 unclassified probably null
R0919:Trpm7 UTSW 2 126831238 missense probably damaging 1.00
R0972:Trpm7 UTSW 2 126805049 missense probably benign
R1109:Trpm7 UTSW 2 126797793 missense probably benign 0.01
R1118:Trpm7 UTSW 2 126822486 missense possibly damaging 0.63
R1278:Trpm7 UTSW 2 126825454 nonsense probably null
R1527:Trpm7 UTSW 2 126830162 missense probably benign 0.18
R1542:Trpm7 UTSW 2 126822599 nonsense probably null
R1882:Trpm7 UTSW 2 126812777 missense probably benign 0.00
R1951:Trpm7 UTSW 2 126831299 missense probably damaging 1.00
R2011:Trpm7 UTSW 2 126823997 nonsense probably null
R2012:Trpm7 UTSW 2 126823997 nonsense probably null
R2026:Trpm7 UTSW 2 126812738 missense probably benign 0.39
R2067:Trpm7 UTSW 2 126797727 missense probably damaging 1.00
R2926:Trpm7 UTSW 2 126858409 splice site probably benign
R3082:Trpm7 UTSW 2 126844422 missense possibly damaging 0.90
R3552:Trpm7 UTSW 2 126826710 splice site probably benign
R3607:Trpm7 UTSW 2 126796428 intron probably benign
R3739:Trpm7 UTSW 2 126851521 missense probably damaging 1.00
R3943:Trpm7 UTSW 2 126831218 missense possibly damaging 0.94
R4161:Trpm7 UTSW 2 126816831 missense probably damaging 1.00
R4176:Trpm7 UTSW 2 126829163 missense possibly damaging 0.83
R4392:Trpm7 UTSW 2 126795509 splice site probably null
R4392:Trpm7 UTSW 2 126848538 missense probably damaging 1.00
R4404:Trpm7 UTSW 2 126833715 missense probably damaging 0.97
R4574:Trpm7 UTSW 2 126797211 missense probably benign 0.01
R4714:Trpm7 UTSW 2 126840783 nonsense probably null
R4807:Trpm7 UTSW 2 126831229 missense probably benign 0.00
R4815:Trpm7 UTSW 2 126858492 missense probably damaging 1.00
R4846:Trpm7 UTSW 2 126813185 missense possibly damaging 0.63
R4972:Trpm7 UTSW 2 126824058 missense probably damaging 1.00
R5097:Trpm7 UTSW 2 126796336 critical splice donor site probably null
R5263:Trpm7 UTSW 2 126821217 missense probably benign 0.34
R5361:Trpm7 UTSW 2 126829241 missense possibly damaging 0.77
R5377:Trpm7 UTSW 2 126842855 critical splice donor site probably null
R5574:Trpm7 UTSW 2 126813030 missense probably benign
R5782:Trpm7 UTSW 2 126797714 missense probably benign 0.04
R5840:Trpm7 UTSW 2 126822611 nonsense probably null
R6044:Trpm7 UTSW 2 126814745 missense probably damaging 1.00
R6178:Trpm7 UTSW 2 126837381 missense probably damaging 1.00
R6457:Trpm7 UTSW 2 126807294 missense probably benign
R6530:Trpm7 UTSW 2 126812711 missense probably damaging 1.00
R6764:Trpm7 UTSW 2 126844420 missense possibly damaging 0.79
R6841:Trpm7 UTSW 2 126813021 missense probably benign 0.00
R6868:Trpm7 UTSW 2 126837414 missense probably damaging 1.00
R7250:Trpm7 UTSW 2 126826765 missense possibly damaging 0.87
R7402:Trpm7 UTSW 2 126799206 missense probably damaging 1.00
X0026:Trpm7 UTSW 2 126829290 missense probably benign
Z1088:Trpm7 UTSW 2 126797281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAACTTTACAATTGGTGCATG -3'
(R):5'- GTAGGGTAAAATGAGTAGCATTCAC -3'

Sequencing Primer
(F):5'- TACAATTGGTGCATGATAAAAGGC -3'
(R):5'- ACCAAGGCTGAAATGTCC -3'
Posted On2018-02-27